Table of content

Diyala Journal For Pure Science

مجلة ديالى للعلوم الصرفة

ISSN: 83732222 25189255
Publisher: Diyala University
Faculty: Science
Language: English

This journal is Open Access


Diyala Journal For Pure Science is quarterly scientific journal published in English language by college of science of university of Diyala and aimed to contribute towards developing and disseminating of knowledge through publishing original and applied researches and review papers in the various fields of pure sciences. The Journal will also serve as an archival record of pure sciences.

Contact info

Table of content: 2014 volume:10 issue:2 - part 2

Geotechnical Evaluation to the Soil of Tikrit University Using Seismic Refraction Method
التقییم الجیوتكنیكي لتربة جامعة تكریت باستخدام الطریقة الزلزالیة الانكساریة


Seismic refraction survey is conducted for geotechnical evaluation to the soil of Tikrit university at allocated site to construct a new building for housing the professors of the university . The measurements of compressionnal and shear waves velocities are conducted along six profiles at the study area . Four main layers were recognized from the results of the seismic data interpretation . Depending on the (Vs/Vp) ratio, three geotechnical properties were calculated for geotechnical evaluation to the different layers, these are Poisson's ratio(σ), Material index (Im) ,Plasticity index (P.i). The contour maps for different layers are plotted to show the distribution of geotechnical properties at the study area. These maps are divided into two zones, Zone A represents the area which has good geotechnical properties ,and Zone B represents the area which has weak geotechnical properties such as loose unconsolidated sediments or weak zones. The results of evaluation show that the first and third layers are fairly competent to intermediate competent layers because they have good geotechnical properties by comparing with second and fourth layers which have poor geotechnical properties which represent incompetent layers. Depending on the values of plasticity index , the sediments of the study area ranges between low plasticity to intermediate plasticity sediments except some of the places characterized by high values of plasticity index representing high plasticity sediments.اجري المسح الزلزالي ألانكساري لغرض التقييم الجيوتكنيكي لتربة جامعة تكريت في الموقع المقترح لإنشاء بناية جديدة لإسكان أساتذة الجامعة. تم تنفيذ قياسات الموجات الطولية والمستعرضة على طول ستة مسارات موزعة ضمن منطقة الدراسة. أظهرت نتائج التفسير للبيانات الزلزالية تمييز أربع طبقات مختلفة في منطقة الدراسة. اعتماداَ على النسبة (Vs/Vp) تم حساب ثلاثة خواص جيوتكنيكية لغرض التقييم الجيوتكنيكي للطبقات المختلفة, وهي نسبة بوزان (σ) ,معامل المادة(Im) ومعامل اللدونة (P.i). رسمت الخرائط الكنتورية لإظهار توزيع الخواص الجيوتكنيكية في منطقة الدراسة, حيث قسمت هذه الخرائط الى نطاقين مختلفين هما نطاق A الذي يمثل المنطقة التي تمتاز بخصائص جيوتكنيكية جيدة ونطاق B ويمثل الرواسب التي لها خواص جيوتكنيكية غير جيدة كانطقة الضعف او الرواسب غير متماسكة. أظهرت نتائج التقييم الجبوتكنيكي لطبقات منطقة الدراسة بان الطبقتين الأولى والثالثة مؤهلتان لإنشاء المشروع السكني بسبب خصائصها الجبوتكنيكية الجيدة مقارنة بالطبقتين الثانية والرابعة اللتان تمتازان بخصائص جيوتكنيكية غير جيدة (غير مؤهلة), كما بينت الدراسة وبالاعتماد على قيم معامل اللدونة بان رواسب منطقة الدراسة تتراوح بين واطئة الى متوسطة اللدونة باستثناء بعض المناطق التي بمعامل لدونة عال تمثل رواسب عالية اللدونة.

Evaluation Blood Markers in Giardia lamblia Parasite Infections in Diyala Province
تقییم المؤشرات الدمویة عند المصابین بطفیلي Giardia lamblia في محافظة دیالى


657 Stool sample was collected from people age between less than 5 years old and 18 years old and more and showed percentage of infection with Giardia lamblia was 8.371 % and samples collected from infection individual blood and non infection individual for Evaluation Blood Markers and effected them mean with the infection . The results of present study showed the mean of Red Blood Cells (RBC) in infected people and non infected was closely with sample decrease in infected people . The mean of White Blood Cells (WBC) it was noted that there was very small increase in infected individuals compared with non infected . it was increase recorded in lymphocytes and eosinophils in infected individuals compared with non infected individuals . it was decrease recorded in each of hemoglobin and neutrophils in infected individuals compared with non infected individuals . There was no difference in monocytes and basophils .جمعت 657 عينة براز لأشخاص تراوحت أعمارهم مابين أقل من خمس سنوات إلى 18 سنة فأكثر وتبين إن نسبة المصابين بطفيلي Giardia lamblia كانت 8.371 % وقد تم جمع عينات من دم المصابين وغير المصابين لتقييم المؤشرات الدموية ومدى تأثرها بالإصابة. وقد أظهرت نتائج الدراسة الحالية أن معدل خلايا الدم الحمراء (RBC) Red Blood Cells عند الأشخاص المصابين وغير المصابين كانت متقاربة مع انخفاض بسيط عند الأشخاص المصابين. وفيما يخص معدل خلايا الدم البيضاء White Blood Cells (WBC) فقد لوحظ وجود ارتفاع طفيف عند الأشخاص المصابين مقارنة بالأشخاص غير المصابين. وتم تسجيل ارتفاع كل من خلايا الدم البيضاء اللمفاوية Lymphocytes و خلايا الدم البيضاء الحمضة Eosinophils عند الأشخاص المصابين مقارنة بالأشخاص غير المصابين . فيما سجل انخفاض في كل من هيموكلوبين الدم Hb و خلايا الدم البيضاء العدلة Neutrophils عند الأشخاص المصابين مقارنة مع الأشخاص غير المصابين . ولم يلاحظ توافر اختلافات في قيم خلايا الدم البيضاء الوحيدة Monocytes و خلايا الدم البيضاء القعدة Basophils عند الأشخاص المصابين مقارنة بالأشخاص غير المصابين .

The association between leptin and some immunological factor with infertility in male and female in Diyala province
دراسة العلاقة بین مستوى ھرمون اللبتین وبعض العوامل المناعیة مع حالات العقم لدى الرجال والنساء في محافظة دیالى


This study has been done in Diyala province from 20/ Nov./2011 to 10/ Oct. / 2012 in general laboratory in Baguba hospital . The main goal of the study is to limit the role of leptin hormone and some immunological factors such as IL – 6 and CRP in infertility in male and female .The study showed that the level of leptin hormone for the infertile male and female ( 18.22 ± 1.26 ) which is higher than the fertile male and female ( 2.53 ± 0.04 ) with statistical difference ( p<0.05 ) , This study showed that the reduction in the level of IL – 6 in infertile male and female ( 34.69 ± 187 ) Comparing with fertile male and female ( 37.28 ± 2.26 ) without statistical difference .mean while the of positive infertile male in the test of CRP ( 35.45 % ) higher than the level of positive fertile male in the test of CRP ( 0.91 % ) and the level of positive infertile female in the test CRP ( 59.09 % ) is higher than the level of positive fertile female in the test CRP ( 4.55 % ) with statistical difference ( p<0.01 )..اجريت هذه الدراسة في محافظة ديالى للفترة من 20 / تشرين الثاني / 2011 م ولغاية 10 / تشرين الثاني / 2012 م في مختبر الصحة العام في بعقوبة ، كان الهدف من الدراسة هو تحديد دور هرمون اللبتين وبعض العوامل المناعية والتي هي IL – 6 و CRP في العقم لدى الرجال والنساء ، بينت هذه الدراسةان مستوى هرمون اللبتيـــن لدى الرجـال العقيـمين والنســــــــــاء العقيـمـات ( 18,22 ± 1,26) اعلى من مستواه لدى الرجال الخصبين والنساء الخصبــات ( 2,53 ± 0,04 ) بفرق احصائي ذو دلالة معنوية ( p<0,05 ) ، فيما لوحظ في هذه الدراسة ايضا ان هناك انخفاضا في مستوى IL – 6 لدى الرجــال العقيمين والنسـاء العقيمـــات ( 34,69 ± 1,87 ) مقارنة بالرجال الخصبين والنساء الخصبات ( 37,28 ± 2,26 ) بفرق احصائي ذو دلالة غير معنوية ، فيما كانت نسبة الرجال العقيمين الايجابين في فحص CRP ( 35,45 % ) اعلى من نسبة الرجال الخصبين الايجابين في فحــص CRP ( 0,91 % ) ، وان نسبة النساء العقيمات الايجابيات في فحص CRP ( 59,09 %) اعلى من نسبة النساء الخصبات الايجابيـات في فحص CRP ( 4,55 % ) بفرق احصائي ذو دلالة معنوية (p<0,01 ).

Synthesis of Dichalcone compounds and Study biological activity
تحضیر مركبات ثنائیة الجالكون ودراسة الفعالیة البایولوجیة لھا


, In this research some new chalcon were prepared Synthesis new derivatives of dichalcones by condensing1-[4-(Ethyl-nonyl)-phenyl]-ethanone with appropriate aldehyde preparation two methods were used to the derivatives of dichalcones , there are condisation , and irridation of microwaves compounds (1-5) Synthesis of new chalcones derivatives containing on the epoxide oxirane ring [ compounds (6-10)] , others contained bromine compounds (11-15) The prepared compounds were identefical uving IR , UV and Nuclear Magnatic Resonance spectra for some of them . The biological activity of the prepared compounds was invejtigated and the prepared compound showed agood inhibition effect aginest some types of micro organisms.تحضير عدد من المشتقات الجديدة للجالكونات من خلال تكاثف المركب الكيتوني 1,1-(1,4-phenylene)diethanone مع الديهايدات مناسبة تحتوي على ذرة ألفا هايدروجين . وكذلك تحضير مركبات ثنائية الجالكون بطريقة التكاثف وأشعة المايكرويف المركبات (5-1) تم تحضير عدد من المشتقات الجديدة للجالكونات حاوية على الأيبوكسايد (الأوكسيران) المركبات (10-6) ، وأخرى حاوية على البروم المركبات ((11-15، -4تم تشخيص هذه المركبات بأستخدام الطرق الطيفية المتاحة وهي طيف الأشعة تحت الحمراء (IR) وطيف الأشعة فوق البنفسجية (UV) وطيف الرنين النووي المغناطيسي (H-NMR) للبعض منها . 5 – دراسة الفعالية البايولوجية لبعض المركبات المحضرة ، وقد تبين بأن العديد منها له قابلية على التثبيط

Hormonal Association between Hyperprolactinemia and Hypothyroidism In Iraqi Infertile Males
مصاحبة ارتفاع البرولاكتین لضمور الغدة الدرقیة في الرجال الغیرقادرین على الانجاب في العراق


The objective of this study is to clarified at least in part the association between hypothyroidism and hyperprolactinemia in Iraqi males which contribute to infertility .Sixty male subjects enrolled in this study.Thirty infertile males as patients group which attended Al-Kindey Hospital during (2010-2011).The other group consiste thirty healthy individuals as control group. The levels of serum thyroid stimulating hormone (TSH), thyroxine (T4), prolactin(PRL),testosteron(Tes),luteinizing hormone(LH) and follicle stimulating hormone (FSH) were estemated utilizing ELISA technique.The results revealed a significant increase in TSH ,PRL,Tes levels ,while a significant decrease in T4,LH,and FSH levels in infertile males comparing to control group was found.A conclusion could be drawn that elevated levels of TSH stimulates prolactin secretion ,which eventually tends to induce infertility in males by influencing spermatogensis and steriodgenesis .الھدف من البحث ھودراسة تاثیر ضمور الغدة الدرقیة على ارتفاع البرولاكتین المؤدي الى عدم الانجاب .شملت الدراسة ستون شخصا من الدكور,ثلاثون من الدكور الغیر قادرین على الانجاب ومصابین بضمور الغدة الدرقیة وثلاثون اخرین من الاصحاءكمجموعة سیطرة. تم استخدام مصل الدم في تقدیر الھرمون المحفز للدرقیة والثایروكسین والبرولاكتین والتیستوستیرون وھرمون الجسم الاصفروالھرمون المحفز للجربیات. اظھرت النتائج وجود زیادة معنویة في مستویات كل من الھرمون المحفزللدرقیة والبرولاكتین والتیستوستیرون في حین اظھرت النتائج وجود انخفاض معنوي في مستویات كل من الثایروكسین وھرمون الجسم الاصفروالھرمون المحفز للجربیات في مجموعة المرضﯨى مقارنة بمجموعة السیطرة. تم الاستنتاج من ھده الدراسة ان ارتفاع مستوى الھرمون المحفز للدرقیة یحفز افراز البرولاكتین والدي یؤدي الى عدم الانجاب وذلك بالتاثیرعلى تخلیق المني والھرمونات الستیرویدیة.

Improving Handwritten Isolated Arabic characters Recognition with Particle Swarm Optimization Algorithm
تحسین تمییز الحروف العربیة المعزولة المكتوبة یدویا باستخدام خوارزمیة أمثلیة حشد الجزیئة


This manuscript considers a new approach to Simplifying pattern recognition based on simulation of behavior of schools of fish and flocks of birds and called particles swarm optimization algorithm (PSOA). We present an overview of the proposed approaches to be optimized and tested on a number of handwritten characters in the experiments as well. Experimental results of the optimization algorithm are found to be very efficient and give higher recognition accuracy. It is noted that the PSOA in general generates an optimized comparison between the input samples and database samples which improves the final recognition rate. Experimental results show that the PSOA algorithm is convergence and more accurate in solution with low error recognition rate .The recognition rate of our proposed system is 87.856% and rate error recognition is 12.142%.هذا المخطوط يعتمد نموذجا جديدا لتبسيط التمييز معتمدا على طريقة محاكاة سلوكية مجموعات من الأسماك وأسراب الطيور تسمى خوارزمية أمثلية حشد الجزيئة .(PSOA). نقدم لمحة عامة عن النهج المقترح ليكون الأمثل واختبار عدد من الرموز المكتوبة بخط اليد في التجارب العملية أيضا. النتائج التجريبية تبين أداء أعلى درجة من هذه الخوارزمية تم التوصل الى أن مثل هذه الخوارزميات يمكن يولد المقارنة المثلى بين عينات من المدخلات وعينات من قاعدة البيانات مما يحسن من معدل التمييز النهائي. النتائج العملية تبين أن خوارزمية حشد الجزئية تعطي أكثر تقاربا، أكثر دقة في الحل مع انخفاض نسبة خطأ التمييز.وكانت نسبة التمييز في نظامنا المقترح هي 87.856% ونسبة الخطأ هي 12.142%.

Study the pattern of some biochemical variables in aborted women
دراسة نمط بعض المتغیرات الكیموحیویة لدى النساء المجھضات


The study was done to determine the relationship between the causes of abortion in women during the second trimester of pregnancy and total fucose (TF) level , protein bound fucose (PBF) , protein bound hexose (PBHex) and some biochemical parameter ,which include : thyroid gland hormones. triiodothyronine (T3 ) tetraiodothyronine (T4) thyrotropin) (TSH) and Testosterone(Test.) progesterone(Prog.) and Prolactin(Prol.) as well as the estimation of the levels of cholesterol(chole.) , triglyceride(T.G) , high density lipoprotein( HDL) , low density lipoprotein ( LDL) , and very low density lipoprotein( VLDL) Samples of ( 53) patients have been collected from Azadi hospital and General Kirkuk hospital who have suffered from abortion where the ages ranged between ( 15 – 44) years divided into three age groups first age group( 15 – 24) years & second age group ( 25 – 34) years & third age group( 35 – 44) years . also the study included (40) healthy persons at same age groups regarded as control groups where the age ranged between ( 18 – 39 ) years. 1- Significant increase (P ≤ 0.01 ) in the levels of (TF & PBF ) and Significant Decrease ) P ≤ 0.01 ) in the levels of (PBHex) in aborted women compared with non – pregnant women 2-Significant increase) P ≤ 0.01 ) in thyroid hormone (T3) for the first & third age group, and there is no significant difference for the second age grouin aborted women compared with non – pregnant women. Significant increase in thyroid hormone (T4) for the first & third age group, and Significant decrease for the second age group in aborted women compared with non – pregnant women. Significant decrease for the first & third age group and Significant increase for the second age group in thyroid hormone (TSH) in aborted women compared with non – pregnant women. 3-Significant increase in Testosterone hormone level For all age Groups in aborted women compared with non – pregnant women And Significant decrease in progesterone hormone level For all age Groups in aborted women compared with non – pregnant women. 4-Significant increase in Prolactin level in aborted women compared with non – pregnant women. 5-Significant decrease in( cholesterol, triglyceride, LDL and VLDL) level in aborted women compared with non – pregnant women. 6-Significant increase in the levels of ( HDL ) for the first age group, and there is no significant difference for the second& third age group in aborted women compared with non – pregnant womenتم دراسة العلاقة بين حالات الإصابة بالاجهاض للثلث االثاني من الحمل ومستويات تركيزالفيوكوز الكلي Total fucose (TF), والفيوكوز المرتبط بالبروتين protein bound fucose (PBF), والسكريات السداسية المرتبطة بالبروتــــــــــين (PBH) protein bound hexose وعدد من المتغيرات الكيموحيوية الاخرى وهي هرمونـــــــــــــــات الغدة الدرقية (Thyroid gland) ثلاثي أيودو ثايرونين (T3)triiodothyronine ورباعي أيودوثايرونين tetraiodothyronine(T4) وثايروكسين ثايروتروبين (TSH ) thyrotropin وهرمونــات البروجستيرون(.Prog) Progesterone والبرولاكتين (.Prol) Prolactin والتيستوستيرون(Test.) Testosteron . وكذلك قياس مستويات دهـــون مصل الدم (الكولستيرول ) (Cholesterol) (Chole.) , و الكليـسيريدات الثلاثية (T.G) Triglyceride . والبروتينـات الدهنية عالية الكثافة (HDL) High Density Lipoprotein . والبروتينات الدهنية واطئة الكـثافة(LDL) Low Density Lipoprotein . والبروتينات الدهنيـــة واطئة الكثافة جداً(VLDL) Very Low Density Lipoprotein. كما تم جمع عينات الدم من مستشفى أزادي التعليمي ومستشفى كركوك العام ومستشفى شوراو الخيري لـ(53) مريضـــة، من النساء اللا َّتي عانين من الإجهاض للثلث الثاني من الحمل و اللا َّتي تتراوح أعمارهن بين (15 ـ 44 ) سنــــة مقسمة إلى ثلاثة فئات عمرية وهي على النحو الأتي الفئة العمرية الاولى من ( 15 ـ 24), والفئة العمرية الثانية من ( 25 ـ 34) والفئة العمرية الثالثة من ( 35 ـ 44) وتم مقارنتها مع ( 40 ) عينة دم لنساء أصحاء كمجموعة ضبط تتراوح اعمارهن بين ( 18 ـ 39 ) سنـــة وكانت النتائج كالآتي: 1 ـ ارتفاع معنوي في مستويات تراكيز كل من الفيوكوز الكلي( (TF , و الفيوكوز المرتبط بالبروتين (PBF ) وانخفاض معنوي في مستوى تركيز ( PBHex ) وللفئات العمرية كافة مقارنة بالنساء الأصحاء . 2 ـ وجود ارتفاع معنوي عالٍ لهرمون الثايرونين ثلاثي يود (T3) وعند مســــــتوى ( P ≤ 0.01 ( بالنسبة للفئة العمرية الاولى والثالثة, وعدم وجود اختلاف معنوي للفئـــة العمرية الثانية مقارنة بالنساء الأصحاء . وجود ارتفاع معنوي عالٍ لهرمون ربــــــــــــــــاع أيودوثايرونين tetraiodothyronine(T4) وعند مسـتوى ( P ≤ 0.01 ( بالنسبة للفئـــــــــة العمرية الاولى والثالثة وانخفاض معنوي للفئة العمرية الثانية . اما بالنسبة للهرمون المحفز للغدة الدرقيـة Thyroid Stimulating Hormone ( TSH ) فقـد أظهرت النتائج ارتفاعا معنويا بالنسبة للفئة العمرية الثانية وانخفاضا معنويا بالنسبة للفئة العمرية الأولى والثالثة مقارنة بالنساء الأصحاء . 3ـ وجود ارتفاع معنوي للتستوستيرون عند مستوى (P ≤ 0.05) ولجميع الفئات العمرية الاولى والثانية والثالثة.اما بالنسبة لهرمون البروجيسترون فقد اظهرت النتائج انخفاضا معنويا ولجميع الفئات العمرية الاولى والثانية والثالثة و عند مســـــــتوى (P ≤ 0.05). 4ـ وجود ارتفاع معنوي عالٍ وعند مستوى( P ≤ 0.01 (بالنسبة لهرمون البرولاكتين و لجميع الفئات العمرية و تقل كلما كانت الفئة العمرية كبيرة. 5ـ وجود انخفاض معنوي عالي في مستويات ( الكولستيرول و الكليسيريدات الثلاثية و الدهون البروتينية واطئة الكثافة (LDL) و الدهون البروتينية واطئة الكثافة جدا(VLDL) في مجاميع النساء اللاتي عانين من إجهاض مقارنة مع النساء الاصحاء. 6ـ وجود ارتفاع معنوي عند مستوى( P ≤ 0.01 ( لتركيز الدهون البروتينية عالية الكثافة (HDL) وللفئة العمرية الأولى فقط وعدم وجود اختلاف معنوي بالنسبة للفئات الأخرى لمجاميع النساء المجهضات مقارنة مع مجاميع النساء الاصحاء .

Microwave –Assisted Synthesis and Characterization of New Heteroaromatic Aldehyde / Ketone- (β-D-ribofuranosyl) thiosemicarbazones
تصنیع ودراسة خواص مركبات جدیدة من الثایو سیمي كاربازون – حلقات غیر متجانسة لللادھاید/ الكیتونات – بیتا – رایبو فیورا نوسیل بأاستخدام المایكرو ویف


A novel synthesis of eleven hetroaromatic aldehyde / ketone of 2- (2,3,5- Tri-O-benzoyl-β-Dribofuranosyl) thiosemicarbazones derivatives (4) have been synthesized by condensation of 2-( 2,3,5- Tri-O-benzoyl-β-D-ribofuranosyl )thiosemicarbazide( 2) with an heteroaromatic aldehyde or ketone (3) ,and then debenzoylated of the resulting product to produce 2-(β-Dribofuranosyl) thiosemicarbazone (5). The synthesis was carried out in ethanol at reflux temperature either by modified domestic microwave oven irradiation or conventional heating (heating mental). Microwave technique gave improved yield in less reaction time All compounds (5a-k) were elucidated by FTIR , 1H-NMR , and elemental analysis .The antibacterial activity of these compounds were tested in vitro by the disk diffusion assay against Escherichia coli as Gram-negative bacteria and Staphylococcus aureus as Grampositive bacteria. Compounds display remarkable antibacterial activity as compared to amoxicillin.تم تصنيع احد عشر مركب جديد من الثايوسيميكاربزايد لسكر الرايبوز والمركبات الحلقيه غير المتجانسه (اليهايدات او كيتونات) (4) وذالك باتباع تفاعل تكاثف الثايوسيميكاربازايد( 2) مع الديهايدات او كيتونات حلقيه غير متجانسه(3) ثم ازيلت مجموعة الحمايه البنزويل من جزء السكر في المركبات للحصول على المركبات النهائيه (β - D - ribofuranosyl thiosemicarbazones 5). انجز التفاعل بالوسط الكحولي واستخدام التشعيع بالمايكروف والتسخين التقليدي .وقد اعطت تقنية المايكرووف ناتج عالي وباقل وقت زمني .اثبتت تراكيب المركبات باستخدام تقنيات : FTIR , 1H-NMR , and CHN .اختبرت هذه المركبات كمواد مضاده للبكتريا باستخدام طريقة disk diffusion) ) ضد ) Escherichia coli) كبكتريا غرام سالب و ( Staphylococcus aureus) كبكتريا غرام موجب . وقد ابدت المركبات نشاط مضاد للبكتريا بصوره جيده بالمقارنه مع مضاد الاموكسيلين .

Characters and Digits Recognition Using Neural Network Learned by Particle Swarm Optimization
تمییز الأحرف والأرقام باستخدام الشبكات العصبیة المعلمة بواسطة سرب الجسیمات الأمثل


The meaning of the Particle Swarm Optimization (PSO) refers to a relatively new family of algorithms that may be used to find optimal (or near optimal) solutions to numerical and qualitative problems. Neural Network is an information processing system that has been developed as generalization models of human cognition of neural biology. In this paper the neural network learned by PSO method to solve one of pattern recognition problems which is considered as one of the important applications in the classification field,instead of using Back Propagation (BP) or Genetic Algorithm (GA) methods. The suggested method is found to learn the NN, to solve characters and digits or decimal numbers (0..9) recognition problem, by modifying the NN weights, this is done by calculating the fitness value which is considered as a threshold value. A comparison studies are made between PSO and Back Propagation (BP) methods in NN learning to specify which is better in solving letter recognition problem.أن تحقيق أمثلية السرب الجزيئي تعني الآشارة الى عائلة جديدة من الخوارزميات التي تستخدم لايجاد حلول مثالية (أو أقرب الى المثالية) للمسائل العددية والكمية. الشبكات العصبية هي نظام معالجة البيانات الذي طور كنموذج لتعميم الادراك البشري لعلم الاحياء البايلوجية. في هذا البحث تم تعليم الشبكة العصبية بطرقة أمثلية السرب الجزيئي لحل احد مسائل تمييز الانماط، بدلا من طريقة الانتشار التراجعي او الخوارزمية الجينية. الطريقة المقترحة وجدت لتعليم الشبكة العصلبة، لحل مسألة تمييز الرموز والارقام العشرية (0..9)، من خلال تعديل الاوزان، وهذا تم من خلال حساب قيمة الأفضلية والتي اعتبرت هي قيمة العتبة. وايضا تم اجراء دراسة مقارنة بين طريقة أمثلية السرب الجزيئي والانتشار التراجعي عند تعليم الشبكة لتحديد الطريقة الافضل عند حل مسألة تمييز الحروف.

Studying Parameters of Cutting mild steel By "Carbon dioxide laser – oxygen and air jet" system
دراسة عوامل قطع الفولاذ واطئ الكربنة بمنظومة لیزر ثاني اوكسید الكاربون ودفق من الھواء والاوكسجین


The target of the present research is to show the optimum cutting speed and suitable pure oxygen gas pressure for particular thickness of mild steel using carbon dioxide laser as a cut tool. The relationships between basic cutting parameters using pure oxygen and mixed gases (90% oxygen and 10% air) were achieved. It was found that the laser power is proportional with the cutting speed for both pure oxygen and gas mixture, but the used power for cutting particular thickness higher for gas mixture in comparison with the pure oxygen. Presentation the correlations between different parameters gives better understanding for laser cutting process in general . In addition, the results of this work maybe support the common idea about CO2 laser as desirable cutting tool for modern technology field. الهدف من البحث الحالي هو اظهار سرعة قطع قصوى بوجود ضغط ملائم لغاز الاوكسجين النقي ولسمك معين من معدن الفولاذ باستخدام ليزر ثاني اوكسيد الكاربون كأداة قطع . العلاقة بين عوامل القطع الاساسية باستخدام اوكسجين نقي ومزيج غازي ( 90% اوكسجين و 10% هواء ) قد تم ايجادها . عند قطع سمك معين قد وجدنا ان قدرة الليزر تتناسب مع سرعة القطع في حالتي استخدام الاوكسجين النقي وخليط الاوكسجين مع الهواء . الا ان القدرة اللازمة لقطع سمك معين اعلى عند استخدام خليط الغاز مقارنة بالأوكسجين النقي ، ان اظهار العلاقات بين مختلف العوامل ستعطي فهما افضل لعملية القطع بالليزر على وجه العموم ، بالاضافة فان نتائج هذا البحث ربما تدعم الفكرة السائدة بان ليزر ثاني اوكسيد الكاربون اداة قطع مرغوب فيها في مجال التكنولوجيا الحديثة .

Study the Physical and Dielectric Properties of Ferrite – Sic Composite
دراسة الخواص الفیزیائیة و العزلیة للمركب فرایت – كاربید السلیكون


The effect of ferrite ceramic Mn-NiFe2O4 , x=0.5 on the Physical and dielectric properties of (Sic) is studies . The sample are prepared by the conventional manufacturing method . We found that the Physical and dielectric properties of Sic chandes considerably with the substituent samples . The variation of dielectric constant as a function of frequency of (ferrite – Sic) composite decrease with increasing frequency and increase with increasing the concentration of ferrite system . It was found that the increase of ferrite system concentration of all our samples produce increasing in mass density and decreasing with A. Porosity.تأثیر المركب منغنیز – نیكل فرایت على الخواص الفیزیائیة العزلیة لكاربید السلیكون قد تم دراستھا .والنماذج حضرت بطریقة التصنیع التقلیدیة .لوحظ من خلال تغیر ثابت العزل مع التردد بأن ثابت العزل یتناقص مع زیادة الترددات وقیم ثابت العزل ازداد مع زیادة تراكیز المركب منغنیز – نیكل فرایت .إما بخصوص الكثافة الكتلیة وجدت أنھا تزداد مع زیادة تراكیز المركب منغنیز – نیكل فرایت في حین أن المسامیة الظاھریة تتناقص مع زیادة تراكیز ھذا المركب .

Seroprevalence of Anti- Cytomegalovirus IgM , IgG antibodies among pregnant women in Diyala province
معدل الانتشار المصلي للضدات النوعیة IgG , IgM لفیروس مضخم الخلایا Cytomegalovirus بین النساء الحوامل في محافظة دیالى


Background: Primary infection caused by human cytomegalovirus (CMV) can lead to serious complications in pregnant women, especially in early pregnancy, because CMV can cross the placenta and cause both fetal and placental infections. Objectives: This study sought to determine the seroprevalence of cytomegalovirus infection and immune status among pregnant women in Diyala province. Subjects and methods: This study was conducted in Baquba-Diyala province for the period from November/2010 to August 2011. 92 pregnant women were chosen from those attending the primary health care centers in Baqubah. The mean age was (29.78 ± 8.155) years, with an age range (15-45) years. Anti- CMV IgM and IgG antibodies were assayed by ELISA technique using (Biokit – ELISA, Hannover-Germany ) according to the manufacturers instructions. Results: the results showed that the anti-CMV IgG, IgM antibodies seroprevalence among pregnant women was (100%), (0%) respectively . Conclusion: It can be concluded that low risk of reactivations or reinfection with Cytomegalovirus among pregnant women.تؤدي الإصابة الأولية بفيروس مضخم الخلايا Cytomegalovirus (CMV) إلى حدوث مضاعفات خطرة لدى النساء الحوامل، خاصة في مرحلة مبكرة من الحمل ذلك بسبب قابلية الفيروس الانتقال عبر المشيمة و التسبب في إصابة كل من الجنين والمشيمة , تسعى هذه الدراسة إلى تحديد معدل الانتشار المصلي للإصابة بفيروس مضخم الخلايا (CMV) وتحديد الحالة المناعية بين النساء الحوامل في محافظة ديالى ، أجريت هذه الدراسة في مدينة بعقوبة محافظة ديالى للفترة من تشرين الثاني / 2011 إلى آب / 2012 . اختيرت 92 امرأة حامل من اللائي حضرن إلى مراكز الرعاية الصحية الأولية في مدينة بعقوبة, كان متوسط العمر (29.78 ± 8.155) سنوات، والفئة العمرية (15-45) سنة . أجريت اختبارات الضدات النوعية IgM ، IgG لفيروس مضخم الخلايا باستخدام تقنية الاليزا ELISA (مقياسة الممتز المناعي المرتبط بالانزيم ) (Biokit – ELISA, Hannover-Germany) وفقا لتعليمات الشركة المصنعة. أظهرت النتائج إن معدل انتشار الضدات النوعية IgG ، IgM لفيروس مضخم الخلايا بين النساء الحوامل كانت (100%) ، (0%) على التوالي , تستنتج الدراسة إن هناك خطورة قليلة عند حدوث إعادة الإصابة بفيروس مضخم الخلايا بين النساء الحوامل.

Combination between static Arithmetic Coding and probability (Dynamic) Arithmetic Coding to compress data
الدمج بین التشفیر الرقمي القیاسي والاحتمالیة ( العشوائیة ) لضغط وتشفیر البیانات


The key idea to arithmetic coding was done and implemented completely by replacing the input symbol with a specific code. A series of symbols can be coded by the interval zero to one, closed interval [0, 1]. Arithmetic coding using many methods and need many bits especially if the message is long and complex, so the compression must be found to reduce the number of bits by using probability methods. Also by combination between methods we can reduce the interval [0, 1] to less than using one method for arithmetic coding.ان فكرة التشفیر الرقمي ھي باستبدال الرمز الداخل بكود معین. وان مجموعة من الرموز من الممكن ان تضغط وتشفر خلال الفترة من الصفر – الواحد . ھناك طرق عدیدة للتشفیر الرقمي وتحتاج الى مراتب كثیرة وخاصة اذا كانت النصوص طویلة ومعقدة ، لذلك سنستخدم ھنا الاحتمالیة وذلك من اجل ضغط ھذه الفترة . بحیث تستخدم مع الطریقة التقلیدیة لتقلیل ھذه الفترة.

Effect of annealing and doping with (Mo , V and Ni) elements oxides on structural properties of BaTiO3 thin films
تأثیر التلدین والتشویب بأكاسید العناصر (V , Mo و Ni) على الخصائص التركیبیة لأغشیة BaTiO3 الرقیقة


In this work, BaTiO3 thin films (pure and doped with oxides MoO3,V2O5 and NiO) were deposited using pulsed laser deposition (PLD) technique with thickness equal to (300nm) on glass and Si (111) substrates at temperature equal to (573K). The effects of annealing at temperatures (673K,773K and 873K) and doping on the structural properties have been investigated. XRD of pure and doped BaTiO3 pellets shows Polycrystalline structure, and exhibited tetragonal structure, with preferential direction (110). The structural properties of the BaTiO3 films prepared on glass substrates before and after annealing have been studied by using XRD technique, these tests show that all the films have amorphous structure at substrate temperature (573K) and after annealing at temperatures (673K,773K and 873K). But in case of Si (111) substrates, the XRD did not detect the crystalline phase before annealing, but annealing at temperature (873K), the XRD detected Polycrystalline structure, and exhibited tetragonal structure of BaTiO3 film . The same occurs with doping films. The surface morphology of all the deposited films was studied using atomic force microscope (AFM). The grain size of the nanoparticles observed at the surface depended on the annealing temperature, where annealing at temperature (873K) was the best temperature at the films deposits on Si (111) substrates. BaTiO3 films with doping ratio (0.1wt%) of NiO has the smallest grain size equal to (44.69nm). RMS roughness increased with increasing annealing temperature.تم في هذا العمل تحضير أغشيــة الباريوم تيتانيت الرقيقة النقية والمشوبة بأكاسيد (المولبدينوم,الفناديوم والنيكل) باستخدام تقنية الترسيب بالليزر النبضي بسمك مقداره (nm300) على قواعد من الزجاج والسليكون (111) بدرجة حرارة أساس مقدارها (573K). تم دراسة تأثير التلدين بدرجات حرارة(873K,773K,673K) والتشويب على الخصائص التركيبية. إن حيود الأشعة السينية (XRD) لأقراص الباريوم تيتانيت النقية والمشوبة اظهر بأنها متعددة التبلور وظهور التركيب الرباعي مع هيمنة الاتجاه(110) . إن الخصائص التركيبية لأغشية الباريوم تيتانيت المحضرة على قواعد من الزجاج قبل وبعد التلدين قد تمت دراستها باستخدام تقنية حيود الأشعة السينية ((XRD, وأظهرت النتائج بأن جميع الأغشية عشوائية التركيب عند درجة حرارة قاعدة (K 573) وبعد التلدين بدرجات حرارة.(873K,773K,673K) لكن في حالة القواعد السليكونية (111), فان حيود الأشعة السينية (XRD) لم يظهر أي طور بلوري قبل التلدين, ولكن عند التلدين بدرجة حرارة ((873K, فان حيود الأشعة السينية ((XRD اظهر بان غشاء الباريوم تيتانيت متعدد التبلور وذا تركيب رباعي. وكذلك الحال نفسه بالنسبة للأغشية المشوبة. تم دراسة طبوغرافية السطح لجميع الأغشية المرسبة باستخدام مجهر القوى الذرية (AFM), أن الحجم الحبيبي للجسيمات النانوية التي ظهرت عند السطح اعتمد على درجة حرارة التلدين, وكانـــت أفضــل درجــة حرارة تلـــدين هـــي ((873K للأغشية المرسبة على القواعد السليكونية (111). امتلكت أغشية الباريوم تيتانيت المشوب باوكسيد النيكل بنسبة تركيز (0.1wt%) اصغر حجم حبيبي حيث بلغت قيمته (nm 44.69). إن خشونة السطح تزداد بزيادة درجة حرارة التلدين.

Effect of Film thickness on Optical and Structural Properties of CdS Thin Films prepared by spray pyrolysis
تأثیر السمك على الخصائص التركیبیة والبصریة لأغشیة Cds الرقیقة المحضرة بطریقة التحلل الكیمیائي الحراري


Cadmium sulphide ( CdS ) thin films were prepared by the chemical Spray Pyrolysis technique on glass substrates at 400°C. The analysis of x-ray diffraction spectra XRD , patterns indicated the presence of single-phase hexagonal CdS which confirmed through the atomic force micrographs (AFM) images. The structural parameters such as interplannar distance (d), lattice constant (a), grain size (D), and micro strain have been evaluated, The crystal growth became stronger and more oriented as seen in the x-ray diffraction spectra and grain size became larger with increasing in the thickness. The optical properties have been studied in the range (300-900)nm. It is observed that the direct band gap energy is inversely depended on film thickness from (2.36–2.34) eV. حضرت أغشية كبريتيد الكادميوم بطريقة التحلل الكيميائي الحراري على قواعد زجاجية وبدرجة حرارة °C 400 .أوضحت نتائج فحوصات حيود الأشعة السينية إن الأغشية المحضرة ذات تركيب متعدد التبلور ونوعها أحادي الطور السداسي وتم تأكيد ذلك من خلال صور مجهر القوة الذرية المتغيرات التركيبية مثل المسافة بين السطوح البلورية (d), ثابت الشبيكة (a), حجم الحبيبات (D) تم دراستها. وأظهرت نتائج فحوصات حيود الأشعة السينية إن حجم الحبيبات يصبح اكبر بزيادة سمك الأغشية , الخصائص البصرية درست في مدى (300-900)nm وأوضحت إن فجوة الطاقة المباشرة المسموحة تتناسب عكسيا مع زيادة سمك الأغشية 2.36–2.34) eV ) .

Computing Well Pairings For Elliptic Curve Group Points
حساب اقترانات ویل لزمرة نقاط المنحنى الاھلیلجي


This work introduce study for one of the relation between points on elliptic curve group which may can use it to attack some of elliptic curve cryptosystems kinds by solving the elliptic curve discrete logarithm problem ( ECDLP ) which are Weil pairings where we describe the basic concepts for elliptic curve group points operation and some type of elliptic curve that we can fined Weil pairing on it and also we explain all the terms concerning with this property and how to compute it by arithmetical example and introduce some of conclusions that we get it in this work .يقدم هذا البحث دراسة لواحدة من العلاقات الموجودة بين النقاط في زمرة نقاط المنحنى الاهليلجي والتي يمكن أن تستخدم لمهاجمة بعض أنظمة تشفير المنحنيات الاهليلجية عن طريق حل مسالة اللوغاريتم المنفصل في المنحنى الاهليلجي وهي اقترانات ويل( Weil Pairing ) حيث نستعرض المفاهيم الأساسية للعمليات الحسابية في زمرة نقاط المنحني الاهليلجي وبعض أنواع هذه المنحنيات التي يمكن إيجاد اقترانات ويل فيها , وكذلك سنوضح جميع المفاهيم المتعلقة بهذه الخاصية وكيفية حساب الاقترانات من خلال مثال عددي ثم نستعرض بعض الاستنتاجات التي تم التوصل إليها من خلال العمل .

Evaluation of the activity of chemical components of Calvatia craniformis mushroom in treatment of Candidal vaginitis in Khalis city women in vitro
تقویم فاعلیة المكونات الكیمیائیة للفطر Calvatia craniformis في علاج التھاب المھبل المتسبب عن الكاندیدا في نساء مدینة الخالص في الزجاج In vitro


Candidal vaginitis is a fungal disease caused by yeast fungi resulting in vaginal discharge , irritation , and itching . This study aims to evaluate the efficacy of the chemical components of Calvatia craniformis mushroom powder in treatment of Candidal vaginitis in women in vitro . Three different concentrations of ethanolic extract were prepered from C.craniformis mushroom powder ( 1 , 0.8 , 0.6 ) % and used as comparison with common antifungal drugs as fluconazole and nystatin . Statistical analysis of values is revealed significant effect ( p<0.05) ) of two concentrations ( 1 , 0.8 ) % ; this result reflected by values of the diameter of zone of inhibition were be ( 2 , 1.6 ) centimeter when were compared with the effect of fluconazole and nystatin which be ( 0.9 , 0.8) centimeter respectively .يعد التهاب المهبل بالكانديدا من الامراض الفطرية المتسببة عن الخميرة الفطرية ، ينتج عن ذلك نزول سوائل التهابية من المهبل ، تهيج للانسجة الداخلية وحكة . تهدف الدراسة الى تقويم كفاءة مكونات الفطر C. craniformis الكيميائية في علاج التهاب المهبل المتسبب عن الكانديدا البيضاء في النساء ، في الزجاج . تم تحضير ثلاثة تراكيز مختلفة من المستخلص الكحولي لمسحوق الفطر C. craniformis ( 0.6 , 0.8 , 1 ) % بالمقارنة مع الادوية شائعة الاستعمال مثل fluconazole وnystatine . أظهر التحليل الاحصائي للقيم وجود تأثير معنوي ( p < 0.05 ) للتركيزين (0.8 , 1 ) % ؛ وعكست هذه النتيجة بتقييم اقطار التثبيط التي كانت ( 1.6 , 2 ) سنتيمتراً بعد مقارنتها مع تأثير الادوية المستخدمة مثل fluconazole و nystatine إذ كانت اقطار التثبيط ( 0.8 , 0.9 ) على التوالي .

Identification Of Trichophyton rubrum Using Polymerase Chain Reaction
تشخیص الفطر ترایكوفایتون روبرم بأستخدام تفاعل البلمرة المتسلسل


Trichophyton rubrum is an anthropophilic dermatophyte that is distributed worldwide and causes common cutaneous disease such as mycosis . Although several properties of this fungus have been investigated so far , however , a few studies were carried out in the field of molecular biology of this fungus . In the present study the application of PCR fingerprinting was performed using two primers : forward 5'TGGTCTGGCCTTGACTGACC3' and Reversed 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' for the purpose of species identification . Trichophyton rubrum isolates obtained from either human patients (5 isolates) and animals ( 5 isolates ) with dermatophytosis were prospectively isolated by cultures and identified on morphological basis at Baghdad University , Department of Dermatology , College of Medicine and College of Veterinary Medicine respectively from the period September 2010 till March 2011 .Trichophyton rubrum isolates were subjected to DNA extraction .Conventional PCR was done with Trichophyton rubrum specific primers 5 ' TGGTCTGGCCTTGACTGACC 3 ' and 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' . Six isolates were positive for DNA extraction .A single band corresponding to Trichophyton rubrum was obtained . The results of current study suggest that PCR is simple , rapid and sensitive method for diagnosis of dermatophyte infections .تعتبر الترايكوفايتون روبرم من الفطريات المحبة للبشر متوزعة في العالم وتسبب الاصابات الفطرية الجلدية مثل المايكوسس . وبالرغم من ان هذة الصفات العديدة لهذا الفطر تم التحري عنها ولكن هنالك دراسات قليلة اجريت في حقل البايولوجي الجزيئي في هذا المجال .في هذة الدراسة تم استخدام فحص البلمرة المتسلسل بوجود نوعان من البرايمير : الاول: 5 ' TGGTCTGGCCTTGACTGACC 3 ' والثاني : 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' لغرض التشخيص .تم الحصول على خمسة عزلات مأخوذة من الانسان وخمسة عزلات من الحيوانات حيث تم تشخيصها بواسطة الزرع الفطري في شعبة الامراض الجلدية/ كلية الطب /جامعة بغداد وكلية الطب البيطري /جامعة بغداد بالتسلسل للفترة من ايلول /2010 ولفاية أذار /2012 وقد اخضعت هذة العزلات الى استخلاص DNA مع أستخدم تفاعل البلمرة المتسلسل العادي وكانت ستة عزلات اعطت وجود DNA وتم تحديدها على شكل Band . هذة الدراسة تقترح بأن فحص تفاعل البلمرة المتسلسل هو بسيط ,وسريع وطريقة حساسة لتشخيص أصابات الفطريات الجلدية.

Dry Blood Spots As Alternative To Conventional Serum Samples In Diagnosting Some Viral Infections
بقع الدم الجاف كبدیل لعینات المصل التقلیدیة في تشخیص بعض الاصابات الفایروسیة


The purpose of this work was to validate the utility of dried blood spot ( DBS) samples for diagnosting HBV infection in comparison with the conventional serum samples. Pair-matched blood samples obtained from six HBsAg positive and four HBsAg negative persons by two ways; venipuncture and fingerstick by lancet and collect blood drops on filter papers (Zelpa type). Blood spots left to dry for two hours on flat bench then placed in nylon bag with dessicant to reduce humidity and stored in the refrigerator for one week. Before examination, blood spots were removed from filter papers and placed in tubes containing phosphate-buffered saline plus tween 80 and left overnight. ELISA for HBsAg screening was applied on sera and blood spot samples. Statistical analysis was done using pearson correlation test to test the optical densities of samples.statistical analysis showed no significant differences between serum and DBS samples and there is a strong linear correlation between the two types of samples. Dried blood spots can be used as successful alternative for serum samples in diagnosing certain viral diseases.الهدف: تم اجراء هذا البحث لغر ض اختبار صلاحية عينات بقع الدم الجافة في تشخيص الاصابة بفايرس التهاب الكبد نمط بي بالمقارنة مع عينات المصل التقليدية. المواد وطرق العمل: تم اخذ عينات دم مزدوجة لستة مرضى موجبين لفحص HBsAg وأربعة سالبين للفحص للمقارنة وبطريقتين (طريقة السحب من الوريد وطريقة وخز الابهام وجمع قطرات الدم على اوراق ترشيح من نوع Zelpa). تركت الاوراق لتجف على سطح مستوي لمدة ساعتين. بعد ذلك وضعت اوراق الترشيح في كيس نايلون مع مادة مانعة للرطوبة desiccant وخزنت في الثلاجة لمدة اسبوع. قبل الفحص تم رفع المناطق الحاوية على قطرات الدم الجاف ووضعها في انابيب تحوي دارئ الفوسفات الملحي مع منظف tween 80 لغرض الفحص في اليوم التالي. أجري فحص الاليزا على عينات المصل والدم الجاف للكشف عن المستضد السطحي للفايرس HBsAg. النتائج: اظهرت النتائج عدم وجود فروق معنوية بين عينات الدم الجاف وعينات المصل وكذلك وجود علاقة خطية قوية بين قيم عينات المصل وعينات الدم الجاف. الاستنتاج: يمكن استخدام عينات الدم الجاف كبدائل ناجحة لعينات المصل ان لم تكن ذات اولوية في تشخيص بعض الاصابات الفايروسية.

Effect of General Non-Slip Condition and MHD on Accelerated Flows of a Viscoelastic Fluid With the Fractional Burgers' Model
تأثیر شرط عدم الانزلاق العام و المجال المغناطیسي الھیدرودینامیكي على التدفقات المتسارعة للموائع اللزجة المرنة مع نموذج بیركر للمشتقات الكسریة


In this paper, the effect of general non-slip condition and magnetohydrodynamic (MHD) on accelerated flows of a viscoelastic fluid with the fractional Burgers’ model are studied. The velocity field of the flow is described by a fractional partial differential equation. By using Fourier sine transform and Laplace transform, exact solutions for the velocity distribution and shear stress are obtained for flow induced by variable accelerated plate. These solutions, are presented under integral and series forms in terms of the generalized Mittag-Leffler function, as the sum of two terms. The first term represents the velocity field corresponding to a Newtonian fluid, and the second term gives the non-Newtonian contributions to the general solutions. The similar solutions for second grad, Maxwell and Oldroyd-B fluids with fractional derivatives as well as those for the ordinary models are obtained as the limiting cases of our solutions. Moreover, in the special cases when     1, as it was to be expected, our solutions tend to the similar solutions for an ordinary Burgers’ fluid. While the MATHEMATICA package is used to draw the figures velocity components in the plane. في هذا البحث تم دراسة تأثير شرط عدم الانزلاق العام و المجـال المغناطيســي الهيدروديناميكــي علـى التدفقات المتسارعة للموائع اللزجة مع نموذج "بيركر". حقل سرعة التدفق وصف بواسطة معادلة تفاضلية جزئية كسرية. باستخدام تحويـلات كل مـن فوريـر و لابـــلاس, تم الحصول على حلول اجهاد القص والحلول الدقيقة لتوزيع سرعة التدفق الناجم عن لوحة التسريع المتغيرة. هذه الحـلول, قدمت بصيغـة التكامل والمتسلسلات بدلالة دالة ميتاج لفلر العامة, كما انها تظهر بصيغة جمع لمصطلحين. المصطلح الاول يمثل حقل السرعة للموائع النيوتونية لأداء الحركة نفسها, والمصطلح الثاني يمثل حقل سرعة المائع اللانيوتوني . تم الحصول على حلول مماثلة لموائع من الرتبة الثانية مثل ماكسويل, و اولدرويد من النمط بي.ذات مشتقات كسرية, وكذلك كحالات محددة تم الحصول على النماذج الاعتيادية. بالأضافة الى ذلك, وكحالات خاصة, تم تغطيتها, عندما كمــا كان متوقعا, حلولنا تميل الى حلـول مماثلة لموائع بيركـــر الاعتيادي. بينما برنامج الماثيماتيكا أستعمل لرسم اشكال مكونات السرعة في المستوي.

Table of content: volume:10 issue:2 - part 2