Table of content

The Iraqi Journal of Veterinary Medicine

المجلة الطبية البيطرية العراقية

ISSN: 16095693
Publisher: Baghdad University
Faculty: Veterinary Medicine
Language: Arabic and English

This journal is Open Access

About

Since 1977- The Iraqi Journal of Veterinary Medicine is the scientific publication of the Faculty of Veterinary Medicine, University of Baghdad. It is published twice a year. The two issues comprise one volume. It Aims at improving and expanding the knowledge in all veterinary fields inside and outside Iraq to make known the research works of Iraqi Scholar to international Veterinary Sciences.

Loading...
Contact info

iraqijvm@yahoo.com

Table of content: 2018 volume:42 issue:1

Article
Molecular detection of Mycoplasma agalactiae and Mycoplasma capricolum in mastitic and non mastitic milk of goats by using Real Time Polymerase Chain Reaction
Mycoplasma agalactiae التحري الجزيئي عن و في الحليب Mycoplasma capricolum المصاب بالتهاب الضرع وغير المصاب في الماعز بواسطة تقنية تفاعل البلمرة التسلسلي الآني

Loading...
Loading...
Abstract

A total of 200 samples were collected from 100 goats from more than one regions within the three governorates (Sulaimani, Erbil and Duhok); all these samples were tested by California mastitis test and these showed the following results: 103 samples (51.50%) were negative in all governorates, 28(14.00%) were trace, 35(17.50%) were (+) mark and 34(17.00%) were (++) mark. Clinical mastitis was observed on 93 out of 200 half udder of goats, in the three governorates; 37(18.5%) were acute mastitis, 27(13.5%) were sub acute mastitis and 19(9.5%) were Chronic mastitis. Examination of extracted DNA by Real Time Polymerase Chain Reaction out of 200 DNA extracted from milk samples of goats only 10 (5.00%) were positive for Mycoplasma agalactiae in the three governorates, 8(80%) from mastatic milk samples and 2 (20%) from non mastatic milk samples in result of M. agalactiae. For Mycoplasma capricolum 6 (3.00%) were positive and all were from mastatic milk. ماعز في أكثر من منطقة ضمن المحافظات الثلاث (أربيل 022 عينة حليب من 022 تضمنت هذه الدراسة جمع 021 : والسليمانية ودهوك) .جميع هذه العينات أجري عليها فحص التهاب الضرع (اختبار كاليفورنيا )وكانت النتائج كالآتي )%++ في جميع المحافظات .شوهد 05.22(10 , + )%05.12(11 ، )%اثري 00.22(02 ،)-( )%عينة كانت سالبة 10.12( )%كان 02.1(15 : نصف ضرع في المحافظات الثلاث وكانت النتائج كالآتي 022 من مجموع 31التهاب الضرع السريري في )%التهاب ضرع مزمن. بفحص الحمض النووي 3.1(03 )%كان التهاب ضرع تحت الحاد و 01.1(05 ،التهاب ضرع حاد Mycoplasma )%عينة موجبة لـ 1.22(02 : الرايبوزي منقوص الاوكسجين المستخلص من عينات الحليب كانت النتائج كالآتي )%كانت من عينات حليب غير مصابة 02(0 )%كانت من عينات مصابة بالتهاب الضرع السريري و 22(2 و agalactiae Mycoplasma capricolum )%كانت موجبة لـ 1.22(6 و ،بالتهاب الضرع للمحافظات الثلاث جميعها من عينات حليب مصابة بالتهاب الضرع السريري من المحافظات الثلاث .


Article
Some physiological and chemical properties of horse and cow blood samples under effect of some different types of anticoagulants
بعض الصفات الفسلجية والكيموحيوية لنماذج دم الخيول والأبقار تحت تأثير أنواع مختلفة من موانع التخثر

Loading...
Loading...
Abstract

The purpose of the present study is to determine and compare the anticoagulants, Ethylene diamine tetra acetic acid, Sodium oxalate, Sodium citrate and heparin in blood samples of horse and bull, through estimation of (Hemoglobin, Packed Cell Volume and Plasma Platelets Count) and plasma physical properties (clarity and volume) and some chemical properties (pH and calcium ion concentration). Five Blood samples were obtained from five stallions and five bulls (20 ml/sample) and were divided as 5 ml in four test tubes containing Ethylene diamine tetra acetic acid, sodium oxalate, sodium citrate and heparin at the College of Veterinary Medicine, University of Diyala. Hemoglobin and packed cell volume were estimated immediately and then the blood samples were centrifuged for 15 min. at 3000 rpm to obtain plasma for evaluating the physical and chemical properties specified above. The horse blood samples pertaining data had no significant elevation in hemoglobin concentration and packed cell volume in Ethylene diamine tetra acetic acid group as compared to other groups, beside having no significant changes in pH between the four treated groups while there was a significant increase in plasma volume of oxalate and citrate as compared to Ethylene diamine tetra acetic acid and heparin, and there was a significant increase in plasma platelet count of Ethylene diamine tetra acetic acid group as compared to heparin. As well there was a significant decrease of calcium ion concentration in Ethylene diamine tetra acetic acid, oxalate and citrate as compared to heparin, while the results of bull blood samples revealed that the hemoglobin and Packed Cell Volume were significantly higher in heparin group than in the oxalate and citrate groups with non significant differences with Ethylene diamine tetra acetic acid group. The plasma obtained from different types of anticoagulants appeared with a high degree of clarity, and the volume of plasma had no significant increase in oxalate and citrate group as compared to other groups. The Plasma Platelet Count and calcium concentration significantly increased in heparin group as compared to other groups. In conclusion, the Ethylene diamine tetra acetic acid was more reliable for horse blood samples while the anticoagulant heparin was more reliable anticoagulant for bull blood samples.الغرض من إجراء هذه الدراسة هو تحديد ومقارنة تأثير موانع التخثر: الأثيلين دايمين تترا اسيتك أسد وصوديوم أوكسالات وصوديوم سترات وهيبارين في عينات الدم من الخيول والأبقار. من خلال قياس (الهيموكلوبين وحجم كريات الدم المرصوص وعدد الصفيحات الدمية في البلازما )وبعض الصفات الفيزيائية للبلازما مثل (درجة النقاوة وحجم البلازما )وبعض الصفات 22( الكيموحيوية للبلازما مثل (درجة الحموضة وتركيزايون الكالسيوم) .جمعت خمسة عينات دم من خمسة خيول وخمسة ثيران مل لكل من أنابيب الاختبار الحاوية على موانع تخثرالاثيلين دايمين تترااستك اسد وصوديوم 5 مل/ عينة )ووزعت بواقع أوكسالات وصوديوم ستريت والهيبارين في كلية الطب البيطري جامعة ديالى تم فحص الهيموكلوبين وحجم كريات الدم 3222 دقيقة بسرعة 15 المرصوص مباشرة بعد جمع العينات ومن ثم وضعت انابيب الاختبار في جهاز الطرد المركزي لمدة دورة /دقيقة للحصول على بلازما الدم لدراسة الصفات الفيزياوية والكيموحيوية لبلازما الدم المذكورة اعلاه. أظهرت نتائج عينات دم الخيول بأن الارتفاع في الهيموكلوبين وحجم كريات الدم المرصوص كان غير معنوي في مجموعة الاثيلين دايمين تترا استك أسد والهيبارين مقارنة مع مجموعة الاوكسلات والستريت ن ع أن درجة النقاوة كانت عالية في جميع العينات كذلك كانت ً فضلا التغيرات غير معنوية في درجة الحموضة لجميع العينات بينما كان هناك زيادة معنوية في حجم البلازما لمجموعة الاوكسالات والستريت مقارنة مع مجموعة الاثيلين دايامين تترا اسيتك أسد والهيبارين ومن جانب اخر أظهرت مجموعة الاثيلين دايمين تترا ً اسيتك أسد ارتفاعا معنويا في تركيز الصفيحات الدمية مقارنة مع مجموعة الهيبارين فضلا عن الانخفاض في تركيز الكالسيوم في كل المجاميع عدا مجموعة الهيبارين، بينما اظهرت نتائج عينات دم الأبقار بان الهيموكلوبين وحجم كريات الدم المرصوص ارتفعت معنويا في مجموعة الهيبارين مقارنة مع مجموعة الاوكسلات والستريت وغير معنوي مع مجموعة الاثلين دايمين تترا اسيتك أسد، كانت درجة النقاوة عالية في جميع نماذج البلازما الى جانب حجم البلازما الذي ارتفاعه غير معنوي في مجموعة الاوكسلات والستريت عن بقية المجاميع، من جانب آخر كان الارتفاع تركيز الصفيحات في البلازما وتركيز ايون الكالسيوم ً معنويا في مجموعة الهيبارين عن بقية المجاميع، يستنتج من هذه الدراسة بأن مانع التخثر الاثيلين دايمين تترا اسيتك اسد اكثر ملائمة لدم الخيول. بينما مانع التخثر الهيبارين اكثر ملائمة لدم الأبقار


Article
Histomorphological investigation of tongue of Porcupine Hystrix cristate
دراسة شكلية ونسجية للسان الدعلج

Loading...
Loading...
Abstract

Anatomical and histological explorations of the tongue in ten adult male Porcupine (Hystrix cristata) collected from AL-Diwanyha city by the hunter, after porcupine prepared the tongue illustrious after that the position, shape dimensions were enrolled. The square-shape of body, thicken less steadily toward caudal part of tongue. Root was tends caudally in the direction of the epiglottis. Torus linguae found on the caudal part of the dorsal surface of the tongue. In the end of lateral surface of tongue have foliate papilla osculate the premolar teeth. The length, apex, body and root of the tongue were (7.6±0.66, 1.25±0.23, 4.95±0.2, and 1.4±0.26 cm), respectively. The width, apex, body, and root of the tongue were (1.80±0.77, 0.35±0.49, 1±0.22 and 0.45±0.14, respectively. In the dorsal and lateral surface have muscle fibers from skeletal type and loose connective tissue bounded by keratinized stratified squamous epithelium while in the ventral lingual surface were non-keratinized. In the dorsal surface of body there were filiform papillae, but less at the lateral surface of the body. While the shape of circumvallate papillae was similar to furrow, and there was taste buds on the both dorsal and lateral sides of the tongue. Fungiform papillae had wide curved keratinized surface, with taste buds on the dorsal surface. Lamina propria and submucosa was loose connective tissue with more of collagen fiber. الوصف العياني والنسجي للسان لعشرة من ذكور الدعلج البالغة والتي جمعها الصيادون في محافظة الديوانية. بعد تحضير الدعلج أخذ اللسان ثم سجلت قياسات وأبعاد وشكل اللسان. قمة اللسان مدورة الشكل تقريبا الجسم مربع الشكل وسمكة يقل تدريجيا كلما اتجهنا إلى الخلف .جذر اللسان ينحدر بطنيا خلفيا باتجاه لسان المزمار.المرتفع اللساني يقع في الجزء الخلفي للسطح الظهري للسان .يحتوي السطح الجانبي من اللسان على الحليمات الورقية والتي تقابل الطواحن وكان معدل طول اللسان الكلي والقمة سم )بالترتيب .وكان عرض اللسان الكلي والقمة والجسم 2.00±4.5 و 2.0±5..4 و 1.25±0.23و7.6±0.66) والجسم والجذر سم )بالترتيب. كما أن الدراسة النسجية أظهرت بأن ألياف 2.45±2.54 و 2.00±4 و 2.5.±2..4 و 2.00±4..2(والجذر العضلات للسطح الظهري والجانبي من نوع الهيكل العظمي والنسيج الضام الرخو تحدها الظهارة الحرشفية الطبقية الكيراتينية ولكنها قليلة في القمة والسطح ، بينما السطح البطني للسان غير متقرن .في السطح الظهري من الجسم وجدت الحليمات الفطرية الجانبي لجسم.اللسان. وأما الحليمات الكأسية ذات شكل دائري على غرار ثلم، وتوجد براعم الذوق على كلا الجانبين الظهرية والجانبية للسان. الحليمات الفطرية لها سطح كيراتيني مقوس واسع، مع براعم الذوق على السطح الظهري. الصفيحة بروبريا والطبقة التحت المخاطية تحتوي على النسيج الضام الغني بألياف الكولاجين


Article
Effect of Zinc Oxide nanoparticals preparation from Zinc Sulphate (ZnSo4) against gram negative or gram positive microorganisms in vitro
تأثير جسيمات أوكسيد الزنك النانوية المحضرة من كبريتات الزنك ضد البكتريا الموجبة والسالبة لصبغة غرام في الزجاج

Loading...
Loading...
Abstract

This research aims to prepare ZnO NPs by using chemical bath deposition way from ZnSO4 and NaOH as starting materials. It was examined by X-ray diffraction, Scanning Electron Microscopy, Zeta potential and Fourier Transformation Infrared. Scanning Electron Microscopy images showed various morphological changes of ZnO nanoparticles obtained by the above method and the different magnification Scanning Electron Microscopy images of the nanoparticle and confirms that the Nano flowers are grown with well-defined morphology and diameters varying between 60-110 nm. The effect of Zinc oxide nanoparticles against bacteria staphylococcus aureus, E.coli and Pseudomous aeruginosa showed the ability of this substance to inhibit the growth of all types of bacteria in different concentrations. The percentage of survival bacteria was (2, 3.7 and 6%) for E.coli bacteria and (1, 1.5 and 5 %) for Pseudomous aeruginosa bacteria, while the percentage was (0.8, 1 and 1.5 %) for staphylococcus aurous respectively for all concentration يهدف البحث إلى تصنيع جزيئات أوكسيد الزنك باستعمال طريقة ترسب حمام كيميائي من كبريتات الزنك وهيدروكسيد الصوديوم كمواد أولية لبدء التفاعل .وقد درست خصائصها باستعمال جهاز حيود الأشعة السينية والمجهر الإلكتروني الماسح، وجهد زيتا المحتملة، تحولات فورييه الأشعة تحت الحمراء وقد أظهرت صور المجهر الإلكتروني الماسح التغيرات المورفولوجية المختلفة من أوكسيد الزنك التي ح صل عليها بالطريقة المذكورة أعلاه .كما اظهرت الصور أشكال الجسيمات النانوية بشكل يشبه . نانومتر 116-06 الازهار وأقطار تتراوح بين درس تأثير جزيئات أوكسيد الزنك النانوية على بكتريا المكورات العنقودية الذهبية والإيشريكيا القولونية والزائفة الزنجارية و قد اظهرت تلك المادة قدرة كبيرة في التأثير في كل انواع البكتريا عند استعمالها ً مختبريا 3 و 2 ( فكانت النسبة المئوية لبقاء بكتريا الإيشريكيا القولونية هي ، بجميع التراكيز المختلفة %) ولبكتريا الزائفة الزنجارية 0 . و 7 1 و 1 (كانت 6 ( %) بينما لبكتريا المكورات العنقودية الذهبية كانت 5 . و 5 1 و 1 . و 8 . %) بالترتيب وعند استعمال جميع التراكيز 5 السابقة


Article
Study of some virulence factors of Aeromonas Spp. isolated from stool samples of children with diarrhea
دراسة بعض عوامل الضراوة لبكتريا المعزولة من براز الأطفال المصابين بالإسهال Spp.

Loading...
Loading...
Abstract

Three hundred samples of stool were collected from children, who are suffering from diarrhea, during the period from October to December 2016 at Fatima Al Zahra and Shaheed al-Sadr hospitals. All bacterial isolates have been submitted to the cultural, microscopical, biochemical examinations, and Vitek 2 system identification to identify Aeromonas isolates. All the isolates under study were tested for their ability to the production of certain factors associated with virulence. It has been concluded that 12 (4%) of collected samples were positive to Aeromonas Spp. The virulence factors of Aeromonas spp. were detected and showed that all the isolates have the ability to produce haemolysin, protease, lipase, phospholipase, gelatinase enzymes, and biofilm on Congo red agar.عينة من أطفال يعانون من الإسهال من مستشفى الزهراء للولادة ومستشفى الشهيد الصدر العام في مدينة بغداد 300 جمعت .زرعت العينات على أوساط زرعية مختلفة لغرض التحري عن 6106 وذلك للمدة من من تشرين الأول ولغاية كانون الأول Aeromonas جراثيم .واختبرت vitek 2 وذلك عن طريق الفحوصات المجهرية والكيموحيوية فضلا عن استعمل نظام Spp. Aeromonas عزلات في الكشف عن قابليتها على انتاج بعض عوامل الضراوة .أظهرت نتائج الدراسة أن نسبة عزل Spp. )كما لوحظ أن جميع هذه العزلات لها القابلية على انتاج السم الحال للدم الهيمولايسين والخميرة الحالة 06( 4%الجراثيم كانت للبروتين البروتنيز والخميرة الحالة للدهون اللايبيز والخميرة الحالة للدهون المرتبطة بالفوسفور الفوسفولايبيز والخميرة الحالة للجيلاتين الجيلاتينيز فضلا عن قدرتها على تكوين الغشاء الحيوي (البايوفلم).


Article
The immune response of rabbits immunized by Salmonella typhimurium and Lactobacillus acidophilus
الاستجابة المناعية للأرانب الممنعة بالسالمونيلا تايفموريم و بكتريا حامض اللبنيك

Loading...
Loading...
Abstract

Antigens prepared from sonicated Salmonella typhimurium (KWCSA-ST) and Lactobacillus acidophilus (KWCSA-LBA) were used to evaluate synergistic effect on interlukine production (IL2, IL-4) and Immunoglobulin-G (IgG) which were evaluated by using Enzyme Linked Immunosorbent Assay and Delayed Type Hypersensitivity-skin test at day 20 post immunization. Twenty five rabbits of both sexes, 2-3 Kg body weight, were divided into five equal groups; the first group immunized by KWCSA-ST (1000 µg/ml) and KWCSA-LBA (1000 µg/ml), the second group by KWCSA-ST (1000 µg/ml) and KWCSA-LBA (500 µg/ml), the third group by KWCSA-ST (1000 µg/ml) as positive control, the fourth group by KWCSA-LBA (1000 µg/ml) as positive control and the fifth group was injected by P.B.S. (pH7.2) as negative control group subcutaneously. The result of delayed type hypersensitivity showed an increase in the means of erythema and induration in the 1st group after 24hrs and 48hrs while the 4th group recorded the lowest mean after 24hrs and 48hrs. These means showed significant differences (P˂0.05) compared with injection by 1:2 and 1:4 diluted Ag. While the results of IgG showed that the highest concentration was at 35th day in the first group while the lowest concentration at 35th day in the fourth group with significant differences (P<0.05). Also the high concentration of IL-2, IL-4 was recorded in the first group at 35th day and the lowest concentration was in the fourth group at 35th day with significant differences (P<0.05); also the results showed significant differences (P<0.05) between the 1st, 2nd, 3rd compared with 4th and 5th groups.صممت الدراسة لتحضيرمستضدات السالمونيلا تايفيموريم ومستضدات بكتريا حامض اللبنيك الكاملة المقتولة المكسرة وتقييم والتي G- ) والكلوبيولين المناعي 4- وانترلوكين 2- تأثيرها التآزري في إنتاج بعض المدورات الخلوية (انترلوكين قيمت باستعمال أرنب قسمت عشوائيا إلى 22 من التمنيع .واستعمل لهذا الغرض 22 فحص الألايزا وفحص الحساسية المتاخر في الجلد في يوم /مايكروغرام1000) خمس مجاميع متساوية ومنعت المجموعة الأولى بمستضدي السالمونيلا تايفيموريم الكاملة المقتولة المكسرة المجموعة الثانية بمستضدي السالمونيلا تايفيموريم ،) مايكروغرام/مل 1000) مل) وبكتريا حامض اللبنيك الكاملة المقتولة المكسرة 5 مايكروغرام/مل )وبكتريا حامض اللبنيك الكاملة المقتولة المكسرة 1000) الكاملة المقتولة المكسرة ،) مايكروغرام/مل 00) المجموعة الرابعة بمستضد ،) مايكروغرام/مل 1000) المجموعة الثالثة بمستضد السالمونيلا تايفيموريم الكاملة المقتولة المكسرة المجموعة الخامسة (مجموعة سيطرة )أعطيت المحلول ،) مايكروغرام/مل 1000) بكتريا حامض اللبنيك الكاملة المقتولة المكسرة مل تحت الجلد. أظهرت نتائج فحص الحساسية المتأخرزيادة في قطر الاحمرار والتصلد للأرانب الممنعة 1الملحي الفسلجي مايكروغرام/مل )وبكتريا حامض اللبنيك الكاملة المقتولة 1000) بمستضدي السالمونيلا تايفيموريم الكاملة المقتولة المكسرة أما المجموعة التي منعت بمستضد بكتريا حامض اللبنيك الكاملة ، ساعة من الحقن 24 مايكروغرام/مل )بعد 1000)المكسرة ساعة على التوالي وكانت هذه الفروقات معنوية 44 و 24 مايكروغرام/مل )أظهرت أقل معدلات بعد 1000)المقتولة المكسرة G . أما بالنسبة لتركيز الكلوبيولين المناعي 1:4 و 1:2مقارنة بالتخافيف والتي كانت في المجموعة الأولى 52 - أعلى تركيز باليوم IL واقل تركيز بنفس الحقبة والتي كانت في المجموعة الرابعة .أما بالنسبة لمستويات IL - و 2 - فأظهرت المجموعة الأولى أعلى 4 اما التراكيز الواطئة في اليوم نفسه والتي كانت في المجموعة الرابعة .كما أظهرت النتائج وجود فروقات معنوية 52 تراكيز باليوم . بين المجموعة الأولى والثانية والثالثة مقارنة بالمجموعة الرابعة والخامسة (P˂0.05)


Article
Incidence of Yersina enterocolitica in sheep in the south region of Iraq
نسبة حدوث اليارسينيا المعوية القولونية في الأغنام في جنوب العراق

Loading...
Loading...
Abstract

Yersiniosis is a zoonotic disease which infects many animal species. A preliminary study was done to detect the incidence of Yersinia enterocolitica in sheep. One thousand and two hundred fecal samples were collected randomly from sheep in four governorates in the southern region of Iraq: Thi-Qar, Al-Muthana, Messan and Basrah, in the period from July 2016 to June-2017. Enrichment Yersinia broth at 4°C for 48 hours was used for isolation of Yersinia enterocolitica. Selective Cefsulodin Irgasan Novobiocin and non selective media were used for bacterial culture. The identification of Yersinia enterocolitica was based on colony morphology and biochemical characters, API 20E and VITEK2 compact systems were used for the same purpose also. Data were analyzed by using SAS, Version 9-1. Chi- square test was used for comparison. The total isolation rate of Y. enterocolitica was 5.16% (62). High and low rates of isolation were recorded in AlMuthana (6. 01%) and Basrah (3.86%). Similarly a significant high isolation rate was recorded in diarrheic sheep (17.4%), moreover the infection rate increased significantly (9.5%) in the young sheep (1day to 6 month's age). Furthermore, the recovery rate of Y. enterocolitica increased significantly during the cold months (12%) as compared with temperate and hot months (spring and summer), at the same instance, non significant variation among sex difference was detected. Fever, diarrhea and mild to moderate degree of dehydration were the most common clinical manifestations observed on the infected animals. Conclusively sheep were considered a source of infection to other species including human being, and the spread of microorganism increased markedly in the cold and wet environment.يعد داء اليارسينيوسيز من الأمراض الانتقالية والذي يصيب فصائل عديدة من الحيوانات وتعد هذه الدراسة الأولى من نوعها في الأغنام بالعراق وتهدف إلى تعيين نسب الإصابة بجراثيم اليارسينيا المعوية القولونية الممرضة .أجريت هذه الدراسة على عينة من براز الأغنام التي تربى في أربع محافظات في جنوب العراق (ذي قار والمثنى وميسان والبصرة) .جمعت عينات 1200 مئوي 4 .واستعمل المرق الغني لجراثيم اليرسينيا بدرجة 2017 إلى حزيران 2016البراز بشكل عشوائي في المدة من تموز . ثم استخدمت الأوساط الانتقائية وغير الانتقائية الصلبة لزراعة الجراثيم ، ساعة 48ولمدة شخصت جراثيم اليارسينيا المعوية القولونية VITEK و API20E استنادا إلى صفات مستعمراتها على الأطباق وخصائصها الكيموحيوية فضلا عن استعمال نظامي لتأكيد نوع جراثيم SAS, version 9 اليارسينيا المعوية القولونية .تم تحليل النتائج إحصائيا باستعمال نظام - بجهاز الحاسوب 1 Chi وقورنت النتائج باستعمال اختبار 5.16% (62) - .بلغت نسبة عزل جراثيم اليارسينيا المعوية القولونية الكلية square )وارتفعت 3. 86%( )وأوطئها في محافظة البصرة 6. 01%(وسجلت أعلى نسبة عزل للجراثيم المذكورة في محافظة المثنى )كذلك ارتفعت نسبة 17.4%( نسبة عزل جراثيم اليارسينيا المعوية القولونية ارتفاعا معنويا في الأغنام التي تعاني من الإسهال الإصابة ارتفاعا معنويا في الأغنام الفتية (يوم- .وسجل تأثير الفصول على نسبة عزل الجراثيم إذ بلغت 9.5% شهور )إذ بلغت 6 ولم تعزل هذه الجراثيم في فصل الصيف .ولم يلحظ تأثير الجنس على نسبة 12% ) أعلى نسبة في فصل الشتاء (الأشهر الباردة الإصابة في الأغنام .سجلت العلامات المرضية للحالات المصابة وكان أهمها الحمى والإسهال الذي تراوح مابين بسيط إلى متوسط الشدة. نستنتج من ذلك أن الأغنام تشكل مصدرا للإصابة بجراثيم اليارسينيا المعوية القولونية خاصة للعاملين بتربية الأغنام ومستهلكي منتجاتها ويزداد انتشار هذه الجراثيم في البيئة الباردة والرطبة


Article
The cytotoxicity effect of Metalloprotease produced and isolated from Aeromonas spp
التأثير السمي لإنزيم البروتييز المعدني المنقى من بكتريا Aeromonas hydrophila

Authors: Muhannad M. Abdallah --- Tahreer H. Saleh
Pages: 41-45
Loading...
Loading...
Abstract

One hundred and fifty stool sampling were collected from clinical sources responsible of causing diarrhea in adults as well as children. The identification of Aeromonas hydrophila isolates depended on common methods of identification dependent on biochemical characteristics and culture, then vitek2 compact system was used. Eight Aeromonas hydrophila isolates were gained and revealed various productivity of metalloprotease; the isolate number 8 was the maximum effective in metalloprotease production. The eight isolates were examined with Polymerase Chain Reaction to prove enzyme gene presence, the results revealed that all isolates were positive for ahMP genes; metalloprotease was completely purified via a number of steps, which included ammonium sulphate precipitation, dialysis, ion exchange and gel chromatography. Cytotoxicity effect of metalloprotease studies on cancer and normal cell lines, The results showed the purified metalloprotease as effective cytotoxic effect on liver hepatocellular cancer cells (HepG2) compared with no effect on normal liver cell line (WRL-68) indicating less cytotoxic effect. جمعت 150 عينة خروج من مرضى يعانون من إصابات الإسهال لعزل بكتريا Aeromonas hydrophila، حُصّلت من هذة العينات على 8 عزلة بكتيرية إخضعت جميعها إلى التشخيص على أساس صفاتها المظهرية والمزرعية وخصائصها الكيموحيوية وقد أشارت نتائج التشخيص إلى أن هناك 8 عزلة بكتيرية من بين العدد الكلي للعزلات. أجري فحص تفاعل إنزيم البلمرة التسلسلي للتحري عن نسبة وجود الجين البروتييز-المعدني الذي هو مسؤول عن إنتاج إنزيم البروتييز-المعدني بوساطة تقنية تفاعل البلمرة التسلسلي وكانت جميع العزلات حاوية على الجين، غُربِلتْ العزلات البكتيرية على أساس قابليتها على تحلل بروتين الكازائين وتكوين هالة شفافة حول المستعمرات. أشارت النتائج إلى أنّ جميع هذة العزلات كانت منتجة للبروتيز ولكن بدرجات متفاوتة، وقد تميزت من بينهما العزلة البكتيرية رقم 8 في انتاجيتها العالية للبروتيز-المعدني، لذا فقد انتُقِيَتْ هذه العزلة لقابليتها في إنتاج الإنزيم. نُقِيَ الانزيم المنتج تحت الظروف المثلى بأربع خطوات تضمنت الأولى الترسيب بكبريتات الامونيوم، الديلزة، التبادل الايوني والترشيح. دُرِسَ تأثير السمية الخلوية لإنزيم البروتييز-المعدني للكشف عن التأثيرالسمي الخلوي للانزيم على الخلايا الطبيعية والسرطانية باستعمال طريقة MTT. اذ اظهرت النتائج التأثير السام لإنزيم البروتييز-المعدني على خلايا (HepG2) باستعمال تركيز قليل من الانزيم، ومقارنة مع خلايا (WRL-68) اذ لم يكن له تأثيرا يذكر


Article
Comparison of the immune response between local manufactured and commercial inactivated Newcastle Disease Virus vaccine in a challenge trail with field isolated Newcastle Disease Virus
مقارنة الاستجابة المناعية بين لقاح مرض النيوكاسل المقتول المنتج محلياً مع التجاري بالتحدي مع فيروس مرض النيوكاسل المعزول في الحقل

Loading...
Loading...
Abstract

Velogenic Newcastle Disease Virus was isolated from broiler chickens in Northern Iraq. An inactivated vaccine was manufactured locally using as seed virus ELD50/ml109 and then compared with commercial inactivated vaccine in an experimental study which included 120 broiler chicks divided into three groups (G1 unvaccinated control, G2 for commercial vaccine and G3 for local vaccine). The chicks were injected subcutaneously at 3 days old followed by booster Lasota live vaccine eye drop. Indirect ELISA technique was used to estimate the antibody titer from the collected sera of chicks at age 7, 17 and 27 days (pre-challenge) and challenged at 31 days old with the same virus. The results indicated that there were significant differences (P<0.05) between vaccinated group G2 and G3 at 27th day old and showed a high antibody level with high protection percentage compared with the control. G1 which shown no survival, 100% mortality and severe histopathological lesions, while in G2 and G3 was 43% and 87% respectively. Post-challenge antibody titers of survival chicks showed in G3 significantly over the G2 with less severe histopathological lesions. This study concluded that vaccine failure could occur due to factors of the immune status of the host, improper storage of vaccine, improper vaccination and variant pathogenic virus strain. More epidemiological surveillances are required to decide the actual impact of the disease in poultry farms and matching the vaccines. عُزل في هذه الدراسة عترة ضارية من فايروس النيوكاسل من مزارع دجاج اللحم في شمال العراق، حُضِرَ اللقاح المقتول المحلي من عزلة فايروس مرض النيوكاسل تم استخدام ELD50/ml109 كبذرة فايروس للقاح المقتول. وقُورنَ باللقاح المقتول التجاري بدراسة تجريبية ضمت 120 من أفراخ الدجاج اللاحم وقسمت إلى ثلاث مجاميع: المجموعة الأولى هي مجموعة السيطرة غير الملقحة في حين لقحت المجموعة الثانية باللقاح التجاري المقتول والمجموعة الثالثة باللقاح المقتول المحلي. حقنت الأفراخ في عمر 3 ايام تحت الجلد فضلاً عن الجرعة المنشطة للقاح لاسوتا الحي عن طريق العين. استعمل اختبار الألايزا غيرالمباشر لتقييم وحساب معيار المناعة عن طريق جمع المصول من المجاميع المدروسة في الاعمار 7 و 17 و27 قبل التحدي وفي العمر 31 يوم تم تحدي بنفس الفايروس. وقد تبين وجود اختلافات معنوية للمجموعتين الثانية والثالثة في عمر 27 يوم اللتان أظهرتا مستوى عالياً من الحماية مقارنة مع المجموعة الأولى التي اظهرت نسبة هلاكات 100% وآفات نسجية مرضية شديدة بينما كانت نسبة البقاء في المجموعتين الثانية والثالثة 43% و 87% على التوالي. كما أظهرت النتائج ان معيار الاجسام المضادة بعد اختبار التحدي قد ازداد في الدجاج الحي وقد تفوقت المجموعة الثالثة معنويا على المجموعة الثانية فضلاً عن علامات نسجية مرضية أقل شدة من المجموعة الثانية. وخلصت هذه الدراسة إلى أن فشل اللقاح يحدث بسبب عوامل الحالة المناعية للمضيف، والتخزين الخاطئ لللقاح، والتطعيم غير اللائق وسلالة الفيروس المسببة للأمراض. المزيد من المراقبة الوبائية مطلوبة لتحديد الأثر الفعلي للمرض في مزارع الدواجن ومطابقتها مع اللقاحات.


Article
Bovine leukosis and the possibility to cause cancer in humans: A scientific review
ابيضاض الدم البقري واحتمالية تسببه بالسرطان في الإنسان: مراجعة علمية

Loading...
Loading...
Abstract

This review was made to explore the recent multiple studies on enzootic bovine leukosis, focusing on its prevalence, economic impact, the link with public health and the possibility to cause cancer in humans. The causative agent of enzootic bovine leukosis is a virus closely related to human T- cell leukemia virus (HTLV-1). The closeness between the two viruses helps the progress of cancer research in diagnosis and treatment, also the development of a vaccine in both human and veterinary medicine .The enzootic bovine leukosis is widely spread in the continents. The economic loses of enzootic bovine leukosis is related to the lowered productivity of effected cattle, morbidity, mortality and cost of control and eradication. This review proved that bovine leukemia virus is innocent from human cancer infection and there is no proof of virus living in human tissues. But this subject needs a lot of research to know the mechanism of the virus and its affects in cellular content of the organism. صممت المراجعة للتحري عن دراسات عديدة أجريت عن مرض ابيضاض الدم البقري المتوطن، وتسليط الضوء على مدى انتشاره والتأثير الاقتصادي له وعلاقته بالصحة العامة وامكانية تسببه بالسرطان لدى الانسان. إن العامل المسبب لهذا المرض هو فايروس ذو ارتباط وثيق بفيروس خلية تي لسرطان الدم البشري (HTLV-1). وقد ساعدت العلاقة الوثيقة بين الفيروسين في تطور بحوث السرطان في مجال التشخيص والعلاج وتطور اللقاح في كل من الطب البشري والبيطري. ان هذا المرض ذو انتشار واسع في عموم القارات والخسائر الاقتصادية الناجمة عن هذا المرض تكمن في انخفاض انتاجية الماشية وشدة الإصابة ومعدلات الوفيات والمبالغ الطائلة التي تنفق من أجل السيطرة وكبح جماح هذا المرض. أثبتت هذه المراجعة التجميعية بأن فايروس ابيضاض الدم لايمت باي صلة لإصابة الإنسان بالانواع السرطانية كما وانه لايوجد أي دليل على وجود الفايروس الحي في الأنسجة البشرية .لكن هذا الامر يحتاج مزيد من البحث في آلية امراضية الفايروس وتأثيره في المحتوى الخلوي للكائن الحي.


Article
Dipstick urine analysis screening among asymptomatic dogs of k9 units
تحليل عينات البول للكلاب البوليسية السليمة ظاهرياً باستعمال أشرطة التحليل

Loading...
Loading...
Abstract

The study was designed to determine the abnormal urine components such as red blood corpuscles, protein, bilirubin, nitrites, specific gravity, glucose, hydrogen ion, ketones, urobilinogen and leukocyte abnormality in k9 dogs urine.The present study was carried out on 135 asymptomatic dogs (65 males and 70 females) with age (2 – 8 years) in Al-Najaf governorate between February 2016 and April 2016. At morning, urine specimens were collected from dogs and tested via method of dipstick. Mass urinary screening is a suitable tool to detect dogs with asymptomatic progressive renal diseases, however the urinalysis can deliver to us information not merely about the kidneys and bladder, but also the liver, pancreas, and other organs, as well as, helping to make a diagnosis, in addition to determining a prognosis (a prediction of the consequence of the disease) and response to treatment. Results showed that 46 (34%) dogs were with urinary abnormalities, hematuria was the most frequent abnormality showed 28(60.9%), nitrituria 10(21.7%), proteinuria 4(8.7%), bilirubinuria in 2(4.3%) and decreased specific gravity 2(4.3%) respectively, pH (0%), glucose (0%), ketones (0%), urobilinogen (0%) and leukocyte (0%). تهدف الدراسة لتحديد مدى وجود خلل في بول كلاب الشرطة بقياس كريات الدم الحمر، البروتين، البيليروبين النايتريت، والكثافة النوعية، الكلوكوز، تركيز الاس الهيدروجيني، الأجسام الكيتونية، اليوروبايلينوجين وكريات الدم البيض لبول تلك الكلاب. أجريت الدراسة على 135 من الكلاب الخالية من أعراض ظاهرية) 65 من الذكور و70 من الإناث) وتتراوح أعمارها من (2- 8 سنوات) في محافظة النجف ما بين شهر شباط 2016 ونيسان 2016. جمعت عينات البول من الكلاب في أول الصباح وفحصت العينات باستعمال الأشرطة الغميسة. إن المسح الكامل للبول مفيد في تحديد أمراض الكلى في الكلاب التي لا تظهر عليها العلامات السريرية,كما ان تحليل البول يوفر المعلومات ليس فقط عن الكلية والمثانة، بل الكبد والبنكرياس وغيرها من الأعضاء فضلاً عن إنه يساعد في تشخيص وتوقع شدة المرض والاستجابة للعلاج. أظهرت نتائج المسح للبول ان 46 (34%) من الكلاب غير طبيعية من بين جميع الكلاب، البيلة الدموية كانت الحالة غير الطبيعية الاكثر شيوعا واظهرت 28 (60%) من الحالات الغير طبيعية، تليها النتريت يوريا 10(21.7%)، بروتين يوريا 4(8.7%)، بلـيروبين يوريــا 2(4.3%) وانخفاض الكثافة النوعية 2(4.3%) زيادة في الكلوكوز (0%)، تغير الاس الهيدروجيني (0%)، الاجسام الكيتونية (0%)، اليوروبايلينوجين (0%) وكريات الدم البيض (0%).


Article
A comparative study of using Kessler Suture Pattern versus Polypropylene meshes implantation to repair Tenotomized Achilles tendon in bucks
دراسة مقارنة لخياطة كسلر وزراعة شبكة البولي بروبلين لإصلاح قطع وتر اكيلس في ذكورالماعز

Loading...
Loading...
Abstract

The aim of the current study was to compare the efficacy of Kessler suture pattern and polypropylene meshes implantation to repair severed Achilles tendons in bucks. For this purpos 16 local adult bucks, weighing 30-35kg were used and equally distributed into two groups, the first group: (control group) and the second group (mesh group). Animals were sedated with xylazine 2% and anesthetized locally with lidocaine hydrochloride 2% infiltrated subcutaneously. Skin incision approximately 5 cm. in length was made over the Achilles tendon. The tendon was isolated by blunt dissection from the underlying tissue, then the left Achilles tendon was transected in its mid portion. In the control group, tenorrhaphy of Achilles tendons were immediately performed by using Kessler suture technique using (polypropylene No. 1). In the second group, a polypropylene mesh was wrapped around the cut ends and fixed to the tendon by simple interrupted stitches of polypropylene thread (No.1). Then skin was sutured by interrupted horizontal mattress using silk No.1. Finally plaster of Paris with window was applied. The skin stitches were removed after 10 days. The clinical signs of all animals showed severe lameness during the first three weeks with no significant differences between the two groups. Lameness reflected significant differences (P<0.05) between groups with the progress of postoperative duration (i.e., starting from 4th week). Rapid absence of lameness was more observed in second group (at 4th week) than in first group (at 6th week). At two months post-operative, a higher percentage (100%) was recorded in first group. While a lower percentage (25%) was showed in the second group. Microscopical examination at two month post-suturing revealed proliferation of fibrous connective tissue around suture materials infiltrated by inflammatory cells, in addition to necrotic tissue attachment to the tendon. In mesh implantation and at the same time there were granulations tissues surrounding the narrow mesh holes with tendon fibers expressed proliferation of tenocytes. At four months, first group revealed few blood vessels, and thickened collagen fibers with mononuclear cells infiltration in cut tendon fibers. In mesh implantation the tendon was retained to its nearly normal structure with few (MNCs) in epitenon. It seemed that both groups gave best outcome in healing of operated tendons with superiority of the second group in comparison with the first group. هدف البحث الحالي معرفة كفاءة خياطة كسلر وزراعة شبكة البولي بروبلين لإصلاح القطع المستحدث في وتر اكيلس في ذكور الماعز. اختير للدراسة ستة عشر من ذكور الماعز البالغة وبوزن 30±35 كغم. قسمت الحيوانات بالتساوي إلى مجموعتين. عُدت المجموعة الأولى كمجموعة سيطرة )خياطة كسلر (أما المجموعة الثانية (مجموعة الشبكة) فقد استعمل لها شبكة بولي بروبلين. استعمل الزايلازين 2% والتخدير الموضعي بمادة الليدوكائين هيدروكلورايد 2%. فتح الجلد بطول خمسة سنتميترات. اجري التشريح الأعمى لفصل الوترعن الأنسجة المجاورة ثم أدخل ملقط قاطع النزف أسفل الوتر واستخدم المشرط الجراحي لقطعه في المنتصف. أُصلح الوتر في مجموعة السيطرة باستعمال خياطة كسلر وبخيط بولي بروبلين قياس (1). زرعت شبكة البولي البروبلين بالمجموعة الثانية حيث تم لفها على الوتر وتثبيتها بغرز من نوع البسيط المتقطع. أغلق الجلد والأنسجة تحته بطريقة المنجد المتوازي وبخيط الحرير قياس (1) ثم استعملت جبيرة باريس لتثبيت منطقة العملية وعملت فتحة بالجبيرة. ازيلت الخيوط الجراحية على الجلد بعد مضي 10يوم. أظهرت النتائج السريرية حصول العرج في جميع الحيوانات حيث لم يلاحظ اي فرق إحصائي معنوي بين المجموعتين في الأسابيع الثلاثة الأولى. بدأ العرج بالاختفاء تدريجياً بدءاً من الأسبوع الرابع بعد العملية حيث لوحظ فرق إحصائي معنوي0.05 >P بين المجموعتين واختفى العرج في الأسبوع الرابع في المجموعة الثانية والأسبوع السادس في المجموعة الاولى. اجري الفحص العياني والنسجي- المرضي في الحقبة الممتدة بين الشهر الثاني والرابع بعد إصلاح الوتر حيث لوحظ في الشهر الثاني وجود التصاقات بين الوتر والأنسجة تحت الجلد وكان نسبتها 100% في المجموعة الاولى ونسبة (25 %) في المجموعة الثانية. أوضح الفحص النسجي المرضي بعد شهرين من الخياطة وجود النسيج الليفي مع ارتشاح الخلايا الالتهابية. في مجموعة الشبكة وفي المدة نفسها لوحظ وجود النسيج الحبيبي الذي أحاط بثقوب الشبكة مع ألياف الغراوين وخلايا الوتر. في الشهر الرابع، اظهرت المجموعة الأولى وجود أوعية دموية قليلة، تثخن ألياف الغراوين مع ارتشاح خلايا وحيدة النواة في منطقة قطع ألياف الوتر. في المجموعة الثانية،عاود الوتر تركيبه الطبيعي مع ارتشاح خلايا وحيدة النواة. نستنتج بأن كلتا التقنيتين تمكنت من إصلاح الوتر مع تفوق واضح للمجموعة الثانية عند مقارنتها مع المجموعة الاولى


Article
Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus
الكشف الجزيئي عن فيروس هربز الخيول نمط 1 في الخيول والحمير المحلية

Loading...
Loading...
Abstract

Equine herpsvirus type1 was classified as a member of the subfamily Alphaherpesvirinae. It was reported to cause respiratory, reproductive and neurologic infection in horses. The reproductive form of the disease induces abortion in pregnant mare, while the neurologic form is associated with paralysis of infected horses. This study was designed for molecular detection of Equine herpsvirus type1 by polymerase chain reaction. Blood buffy coat samples were collected from 25 horses (Equus feruscaballus) and 25 donkeys (Equus asinus) admitted to local private veterinary clinics around Baghdad and Baaquba cities. DNA was extracted from such samples by the use of DNA extraction kit of COLLECTAGENET .The samples were subjected to conventional PCR test using specific primers for gB gene of equine herepesvirus-1. Forward primer (F) (5’ TAACTGAGATCT AACCGAC 3’) and reverse primer (R) (CATATATAGCTATCACGTCC 3’). One buffy coat sample from aborted mare and one buffy coat sample from a donkey suffering from acute respiratory clinical signs were inoculated in mice to follow the fate of equine herepesvirus-1in nasal turbinates, cervical lymph nodes and lungs of these mice. The results showed that only 4 samples from horses and 2 samples from donkeys were positive to polymerase chain reaction. Experimentally infected mice did not show any clinical signs but they were positive to polymerase chain reaction, and the virus easily terminated, probably due to low dose of the virus and host specificity. It can be concluded that local horses and donkeys, somewhere have had infected with equine herepesvirus-1, and became latent carriers for the virus. Furthermore, microbiological and epidemiological studies on local Equine herpsvirus type1 and Equine herpsvirus type 4 are recommended ان فيروس هربز الخيول نمط واحد قد صنف ضمن العائلة الفا لفيروسات الهربز. وأشارت التقارير انه يسبب إصابات تنفسية وتكاثرية وعصبية في الخيول المصابة. إن الإصابة التكاثرية تسبب الاجهاض في الأفراس بينما يكون شكل الإصابة العصبي مقرون بالشلل. صُممت هذه التجربة للكشف الجزيئي عن فيروس هربز الخيول نمط 1 في الخيول والحمير المحلية باستعمال اختبار تفاعل سلسلة انزيم البلمرة. حيث جُمعت 25 نموذج من خلايا الدم البيضاء من الخيول المحلية (Equus feruscaballus) و 25 نموذج من الحمير المحلية (Equus asinus) أثناء ورودها إلى العيادات البيطرية الخاصة حول مدينة بغداد وبعقوبة. إستُخلص الـDNA من النماذج باستعمال عدة الإستخلاص من شركة COLLECTAGENET وأجري إختبار تفاعل سلسلة انزيم البلمرة للنماذج باستعمال بادئين لنسخ الجين gB لفيروس هربز الخيول وهما F(5’TAACTGAGATCTAACCGAC 3’) و R(5’CATATATAGCTATCACGTCC 3’). واستعمل نموذج واحد مأخوذ من فرس مجهضة ونموذج واحد مأخوذ من حمار يعاني من التهابات تنفسية حادة وحقنت هذه النماذج منفردة بالفئران البيضاء وفي فتحة المنخرين لمتابعة تطور ونهاية المستضد في المنخرين والرئتين والعقد اللمفاوية الرقبية. أظهرت النتائج ان اربعة نماذج خلايا دم مأخوذة من الخيول موجبة لوجود فيروس هربز الخيول نمط 1 ونموذجين من الحمير موجبة أيضاً. أما الفئران المحقونة بخلايا الدم البيضاء من الفرس والحمار فلم تظهر أية علامات مرضية وقد يكون هذا بسبب قلة عدد الفيروسات المحقونة كما أظهر اختبار تفاعل سلسلة انزيم البلمرة الذي أجري لنماذج الأنسجة من الفئران سرعة في اختفاء الفيروس. نستنتج من هذه الدراسة وجود فيروس هربز الخيول نمط 1 في الخيول والحمير المحلية التي قد تكون متعرضة للأصابة في وقت ما واصبحت حاملة للمسبب المرضي. وتوصي الدراسة بضرورة إجراء مسح عام للخيول والحمير العراقية لمعرفة مدى انتشار فيروس هربز الخيول نمط 1 و4 وعزل الفيروس منها.


Article
Selection of male goat embryos in vitro by using swim-up of epididymal spermatozoa
اختيار الأجنة الذكرية للماعز مختبرياً باستعمال طريقة السباحة للأعلى لنطف البربخ

Loading...
Loading...
Abstract

The main objectives of this study is the separation of X from Y bearing epididymal spermatozoa of local buck by swim-up, and the use of this spermatozoa for in vitro fertilization to determine the percentage of produced male and female embryos. The sex of produced embryo was identified by polymerase chain reaction. Testis of the local buck were obtained from Al-Shu'alah abattoir and the epididymal spermatozoa were harvested from the cauda by and submitted to in vitro maturation prior to separation of X from Y bearing spermatozoa and prior to their use for in vitro fertilization. For the separation of epididymal spermatozoa, swim-up technique was used with centrifugation at 200×g or 300×g. The centrifugation at 200×g showed that 41.84±1.39 % of spermatozoa were detected in the supernatant while the precipitate contained 50.69±0.71 and the mean of the sperm lost was 7.65±0.93. After centrifugation, spermatozoa in the supernatant were used for in vitro fertilization of matured oocytes. The sex of in vitro produced goat embryos was determined by polymerase chain reaction using specific primers to detect of SRY gene. The percentage of total goat embryos obtained after in vitro fertilization by sperms selected using swim-up at centrifugation force of 200×g recorded 79.66 % male embryos while female embryos recorded only 20.33 %. At the end, the results showed the ability of selection male embryos in caprine by application of swim-up technique on epididymal spermatozoa with centrifugation at 200×g. الأهداف الرئيسة لهذه الدراسة هو فصل النطف التي تحمل X عن الحاملة Y كروموسوم للحيوانات المنوية من ذيل البربخ لذكور الماعز المحلي بواسطة تقنية السباحة للأعلى واستعمال هذه النطف للإخصاب الخارجي لتحديد النسبة المئوية للأجنة الذكور والإناث المنتجة مختبرياً. حُدد جنس الجنين المنتج بواسطة تفاعل سلسلة البلمرة .حُصل على خصى ذكور الماعز المحلي من مجزرة الشعلة وحُصل على النطف من ذيل البربخ وكُيفَت في المختبر قبل البدء بفصل النطف الحاملة X عن الحاملة Y تحمل واستعمالها للإخصاب في المختبر. لأجل اختيار نطف ذيل البربخ الحاملة Y كروموسوم استعملت تقنية السباحة للأعلى بواسطة استعمال قوة طرد مركزي تعادل 200×g و 300×g. أظهرت قوة الطرد المركزي عند 200×g أن 41.84 ± 1.39٪ من النطف التي كشف عنها في الطافي بينما احتوى الراسب على 50.69±0.71 % وكان معدل الحيوانات المنوية المفقودة 7.65±0.93. بعد الطرد المركزي، استعملت الحيوانات المنوية في الجزء الطافي للإخصاب الخارجي للبويضات الناضجة. حُدد جنس أجنة الماعز المنتجة في المختبرعن طريق تفاعل سلسلة البلمرة باستعمال برايمر خاص للكشف عن جين SRY. بلغت النسبة المئوية لأجنة الماعز الكلية التي حُصل عليها بعد الإخصاب الخارجي من النطف المختارة باستعمال تقنية السباحة للأعلى وبقوة الطرد المركزي 200×g سجلت 79.66٪ من الأجنة الذكور بينما سجلت الأجنة الإناث فقط 20.33٪. أخيراً، أظهرت النتائج قدرة اختيارالأجنة الذكور في الماعز عن طريق تطبيق تقنية السباحة للأعلى على النطف من ذيل البربخ وبقوة الطرد المركزي 200×


Article
Effects of contaminated feed with Aspergillus flavus on some hematological and biochemical parameters on Cyprinus carpio L. 1758
تأثير تلوث الغذاء بفطر الرشاشيات الصفراء على بعض المعايير الدموية والبايوكيميائية لسمكة الكارب الاعتيادي Cyprinus carpio L. 1758

Loading...
Loading...
Abstract

In this investigation the common carp, Cyprinus carpio L. 1758 was exposed to contaminated feed with Aspergillus flavus under laboratory aquarium conditions (glass ponds) for 90 days. Results revealed that the contaminated feed with (A. flavus) has significantly affect in body weight change, blood and biochemical parameters of groups fed on contaminated feed with A. flavus. Body weight changes were decreased in group feeding on contaminated feed with A. flavus in comparison with control group. The results showed decreases in RBCs, PCV% and Hb concentration but WBCs was increased in treatment fish in comparison with the control group. In addition, serum Glutamic pyruvic trans-aminase, Glutamic oxaloacetic trans-aminase and total cholesterol as compared to control showed an increase (P<0.05) in these parameters in contaminated fish but total protein was decreased in same groups. In conclusion, A. flavus is produced toxic compounds that represent a serious source of contamination in foods; this confirms the infection of aquacultures’ fishes with A. flavus. So, one should not store foods for long periods or under poor conditions, fish health problems may arise. عرضت أسماك الكارب الاعتيادي Cyprinus carpio L. 1758 للغذاء الملوث بفطر الرشاشيات الصفراء مع التغذية وتحت ظروف البيئة المائية المختبرية (بيئة الأحواض الزجاجية) لمدة 90 يوما. أظهرت النتائج تأثير تلوث الغذاء بفطر الرشاشيات الصفراء على وزن الجسم، الصورة الدموية والفحوصات البايوكيمياوية للمجاميع التي غذيت بالغذاء الملوث بفطر الرشاشيات الصفراء. وزن الجسم انخفض في المجاميع التي غذيت بالعلف الملوث بفطر الرشاشيات الصفراء بالمقارنه مع مجموعة السيطرة. كذلك فُحِصَت الصورة الدموية لأسماك مجموعتي السيطرة والمغذية بالغذاء الملوث بفطرالرشاشيات الصفراء لوحظ بالنتائج نقصان بأعداد كريات الدم الحُمر، ونسبة حجم الخلايا المرصوصة وتركيز خضاب الدم، لكن أعداد كريات الدم البيضاء زادت في مجموعة أسماك المغذية بالعلف الملوث بالفطر بالمقارنة مع مجموعة السيطرة.فضلاً عن ذلك قيس كلوتامك بايروفك ترانز امينيز وكلوتامك أوكزالو اسيتيك ترانز امينيز والكولستول الكلي والبروتين الكلي في الأسماك المغذية بالعلف الملوث مع مجموعة السيطرة، لوحظ بالنتائج زيادة هذه القيم في مجموعة المغذية بالعلف الملوث بالمقارنة مع مجموعة السيطرة لكن البروتين الكلي قلت قيمته في نفس المجموعة .(P<0.05) يستنتج من هذا أن الرشاشيات الصفراء تنتج مركبات سامة تمثل مصدر خطير لتلوث الغذاء وهذا تأكيد على إصابة أسماك التربية بفطر الرشاشيات الصفراء. لذا يجب عدم خزن الطعام لفترة طويلة أو تحت الظروف السيئة لما تسببه من مشاكل في صحة الأسماك.


Article
Ultrasonography of urinary system in normal Iraqi buffaloes (Bubalus bubalis
الفحص بالأمواج فوق الصوتية للجهاز البولي في الجاموس العراقي (Bubalus bubalis)

Loading...
Loading...
Abstract

The objective of this study was to evaluate the usefulness of ultrasound in the examination of urinary system in buffaloes. Ultrasonography of the urinary system was done for 60 local buffaloes breed, 1-15 years old of both sexes in Mosul/Iraq, and they then were divided into two groups according to age, 25 calves less than 2 years and 35 adults 2-15 years. Kidney measurements are taken from three different sites (right lumbar, right sublumbar and right twelfth intercostal space. The right sublumbar region is the best area for getting good ultrasonographic images (in both adult and calves) followed by right lumbar region which gives clear images in adult buffaloes. Ultrasonographic examination for the left and right kidneys in adult buffalo and their calves showed no significant difference in kidney measurements from different sites (lumbar, sublumbar, twelve intercostal space). The results showed that the mean thickness of right kidney of buffaloes aged 2-15 years from right sublumbar region was (7.40±0.13) centimeters and in buffalo calves was (5.29±0.23) cm. The mean thickness of left kidney of buffaloes from right sublumbar region was (7.30±0.20) cm, and in buffalo calves was (5.06±0.59) cm. The urinary bladder is easily observed by ultrasonography per-rectum in adult and percutaneous in calves (right sublumbar region). The urinary bladder appears as circumscribed round to oval structure in the pelvic area. It usually contains anechoic to hypoechoic urine. The wall of urinary bladder is echogenic, smooth and its thickness varies with the amount of bladder distention. Positive correlation between right kidney thickness (cm) (from right sublumbar region) and the age (months) for buffaloes (0.627). أجريت هذه الدراسة لتقييم كفاءة استعمال الأمواج فوق الصوتية في فحص الجهاز البولي للجاموس العراقي. شملت الدراسة فحص الجهاز البولي في 60 رأس من الجاموس المحلي تراوحت أعمارها بين 1-15 سنه ومن كلا الجنسين، قسمت حيوانات الدراسة إلى مجموعتين وحسب العمر إلى 25 عجل أقل من 2 سنه و 35 جاموس بالغ بعمر 2-15 سنه .أخذت قياسات الكليتين بالفحص عبر الجلد من ثلاث مناطق مختلفة من جسم الحيوان (القطنية اليمنى، تحت القطنية اليمنى، المسافة 12 ما بين الاضلاع اليمنى ). بينت النتائج أنّ منطقة تحت القطنية اليمنى هي الأفضل للحصول على أنسب صور بالأمواج فوق الصوتية (في كل من العجول والجاموس) تتبعها منطقة القطنية اليمنى إذ أمكن فيها الحصول على صور واضحة للجاموس البالغ. اظهرت نتائج الفحص بالأمواج فوق الصوتية لكل من الكلية اليسرى واليمنى في الجاموس البالغ والعجول عدم وجود فروق معنوية في قياسات الكلية من المناطق المختلفة (القطنية، تحت القطنية، المسافة الثانية عشر ما بين الاضلاع(. بينت الدراسة أن متوسط سمك الكلية اليمنى في الجاموس من المنطقة تحت القطنية اليمنى (7.40±0.13) سم وفي عجول الجاموس (5.29±0.23) سم، في حين أنّ متوسط سمك الكلية اليسرى في الجاموس من المنطقة تحت القطنية اليمنى (7.30±0.20) سم, وفي عجول الجاموس (5.06±0.59) سم. كشفت الدراسة عن سهوله إجراء فحص المثانة البولية بالأمواج فوق الصوتية عبر المستقيم في الحيوانات البالغة وعبر الجلد في العجول (المنطقة تحت القطنية اليمنى)، وقد ظهر جدار المثانة البولية بسمك مختلف حسب كمية البول الموجود داخل المثانة وظهرت المثانة البولية بشكل دائري إلى بيضوي داخل التجويف الحوضي وتحتوي بالغالب على بول عديم الصدى إلى قليل الصدى بينما كان جدار المثانة رقيق ذو صدى وبسمك مختلف بالاعتماد على مدى توسع المثانة.أثبتت النتائج وجود علاقة ترابط موجبة بين سمك الكلية اليمنى (سم) (من المنطقة تحت القطنية اليمنى) وعمر الجاموس (بالأشهر) وكانت (0.627(.


Article
Immunological and molecular study of Chlamydia trachomatis as causative agent of abortion in Al-Muthanna province
دراسة مناعية وجزيئية للتحري عنChlamydia trachomatis كعامل مسبب للإجهاض في محافظة المثنى

Loading...
Loading...
Abstract

Chlamydiasis during pregnancy should be considered a significant risk factor for adverse pregnancy outcomes in humans. 120 women who had a single or repeated abortion were selected for this study, and they were referred with a physician report for TORCH tests to determine the final diagnosis of pregnancy loss. The control were (40) healthy pregnant women with a history of a normal pregnancy. The innate immunity in abortive women was higher than normal pregnancies, that was estimated by Nitroblue Tetrazolium test done to estimate the phagocytic activity, there was a significant increase (P=0.009) in phagocytic activity in the leukocytes of abortive women which was (22%) higher than that in control. Also, the cellular immune response was higher in abortive women than that in control. Methyl Thiazolyl Tetrazolium assay was performed to estimate lymphocyte transformation index of peripheral blood leukocytes in abortive women. The results of Methyl Thiazolyl Tetrazolium assay showed a significant increase (P=0.001) in the lymphocyte transformation index in the lymphocytes of abortive women which was (27%) higher than control. The serological detection by ELISA showed that anti-C. trachomatis IgG was (14.2%), and the molecular detection by Quantitive Real Time-Polymerase Chain Reaction showed positive results (17.5%) of total abortive women. The present study demonstrated a high level of relationship between C. trachomatis and abortion among women in the study samples. The age group (20-25years) was the most susceptible to chlamydial infection and the infection was higher in recurrent miscarriages than in single miscarriage. ان الإصابة الأولية للأم بداء الكلاميديات أثناء الحمل يعد عامل خطر لنتائج الحمل السلبية. أختير 120 امرأة مجهضة اجهاض مفرد أو متكرر بعد احالتهن للمختبر بتقرير طبي للتحري عن نوع المسبب لتحديد التشخيص النهائي لفقدان الحمل، وأختير 40 عينة من الحوامل الطبيعية مجاميع سيطرة. وقد تبين من خلال التجارب ان المناعة الطبيعية في النساء المجهضات أعلى من المناعة الطبيعية للنساء الحوامل، والتي قيست بإختبار قياس الفعالية البلعمية، حيث أظهر التحليل الإحصائي فرق معنوي (0.009) في معدل البلعمة لكريات الدم البيضاء للنساء المجهضات بنسبة أعلى من الحوامل الطبيعية بمقدار (22%). وقيست الإستجابة المناعية الخلوية باختبار تحول الخلايا اللمفاوية، وقد أظهرت النتائج زيادة معنوية (0.001) في التحول اللمفاوي للخلايا اللمفاوية في دم النساء المجهضات بنسبة أعلى من الحوامل الطبيعية بمقدار (27%). وقد استعملت الطرق المصلية والجزيئية للتحري عن Chlamydia trchomatis، حيث اجري اختبا الألايزا غير المباشر للجسم المضاد IgG وسجلت نتائج الاختبار نسبة(14.2%) حالات موجبة. كما أجري تفاعل البلمرة المتسلسل الكمي، وقد سجلت النتائج الموجبة بواقع 17.5%)). أظهرت الدراسة وجود علاقة وطيدة بين الإصابة بداء الكلاميديات وحدوث الاجهاض، وكانت الفئة العمرية (20-25) سنة هي الأكثر إصابة بداء الكلاميديات، وأن داء الكلاميديات كان أكثر حدوثاَ في حالات الاجهاض المتكرر


Article
Epidemiological study of thermophlic Campylobacter isolated from diarrheic and non diarrheic cows in Baghdad governorate
دراسة وبائية للكمبايلوبكتر المحبة للحرارة المعزولة من الأبقار المصابة بالإسهال وغير المصابة في محافظة بغداد

Loading...
Loading...
Abstract

The study achieved isolating Campylobacter spp from diarrheic and non-diarrheic cows and studying the percentage of diarrhea in 10 areas in Baghdad governorate (Al-Shulah, Abou Ghrayb, Kadimyiah, Sadr City, Suwayrah, Mahmoodyiah, Latifyiah, Al-Radwaniyah, Howr Rijab and Yousfyia). One thousand fecal samples were cultured on different selective culture media specific for Campylobacter spp, and different biochemical tests were used (Oxidase reaction, Oxoid biochemical identification system campy, Tripple Sugar Iron (TSI), hippurate hydrolysis and the use of Vietik (NH). Eighty isolates of Campylobacter spp were recorded (8%). Campylobacter spp isolates included C. jejuni 30(3%), C. coli 30(3%) and C.lari 20(2%). High percentage of diarrhea was recorded in Howr Rijab and Abou Ghrayb 70(82.35%), 81(81.81%) respectively, while lower percentage of diarrhea was in Mahmoodyiah and Yousfyia in percentage 43(39.09%) and 50(46.72%), High percentage of campylobacter isolates was recorded in Al-Shulah 15(18.75%), while lower percentage of isolates was recorded in Howr Rijab and Yousfyia 5(6.25%) and 4(5%) respectively. Age group one day to one month gave the highest isolation rate 50% (40) while lowest isolation rate in age group (6 months to 1year) 5% (4) under (P˂0.0001) level. The highest isolation rates were recorded in Summer 2016 (19.16%) and Summer 2017 (24.32%) while the lowest isolation rates was recorded in Winter (0.8%). Animals infected with C. jejuni and C coli, showed obvious clinical signs including depression, loss of appetite and inability to feed newborn calves, they suffered from severe diarrhea and dehydration, and the presence of blood and thick mucus, high fever were observed in some animals, while in animals infected with C. lari the clinical signs were mostly within normal limits. It can be concluded that two species of campylobacter (C. coli and C. Lari) isolated from diarriheic cows are new species added to the two species of campylobacter (C. fetus and C. Jejuni) previously isolated from cows in Iraq and increasing the total campylobacter species confirmed in Iraq to four spp. ص ممت الدراسة لعزل بكتريا الكمبايلوبكتر ومعرف ة نس بة الإص ابة به ا ف ي الأبق ار المص ابة وغي ر المص ابة بالإس هال ودراس ة ، المحمودي ة ،الص وير ، مدين ة الص در ، الكاظمي ة ،اب و غري ب ، من اطم م ن محاف ة بغ داد و ي (الش علة 01 نس بة الإس هال ف ي عينة براز على مختلف الأوساط الزرعي ة والأختب ارات الكميوحيوي ة 0111 ور رجب واليوسفية .)زرعت ، الرضوانية ، اللطيفية الاختياري ة الخاص ة ببكتري ا الكمب ايلوبكتر) TSI, hi ، الاوكس يديز O.B.I.S . .وأظه رت ppurate hydrolysis (Vietik NH )%شملت العزلات ثلاثة انواع مختلفة من بكتريا الكمبايلوبكتر 0( عزلة بكتيرية مثلت 01النتائج الحصول على و ي C.Jejuni 70(82.35%) . س جلت أعلى نسبة للإسهال في ور رجب وأبوغريب بنسبة 20(2%) C.lari و 30(3%) C.coli و 30(3%) )وق د 37.62%( و 39)93.13%( بينما انخفضت نسبة الإسهال في المحمودية واليوس فية بنس بة ، على التوالي 00)00.81%), مثلت الشعلة أعلا ا بالنسبة لعدد عزلات الكمبايلوبكتر 15 ( بنسبة بينما سجلت منطقة ور رج ب واليوس فية أق نس بة 18.75%) 5(6.25%), 4(5%) عزل وكانت ي و 0( على التوالي أما فيما يخص تأثير العمر فقد أظهرت النتائج ان الفئة العمرية للعجول من 4(5%) س نة واح د )بنس بة – شهور 7( بينما أق نسبة عزل سجلت في الفئة العمرية 40(50%) شهر )أكثر نسبة عزل وبلغت – حي بلغ ت النس بة 2106 و 2107 أما تأثير الموسم فقد كانت أعلى نسبة للإصابة ف ي ص يف P<0.0001 وبفارق معنوي واضح (0.8%) بينم ا كان ت أق نس بة ع زل ف ي فص الش تاغ حي بلغ ت النس بة 2107 ف ي (19.16%) و 2106 ف ي (24.32%) C.jejuni والحيوانات المصابة ب و C.coli أظهرت علامات سريرية واضحة تمثلت بالخمول وفقدان الشهية وعد القدر على تغذية العجول حديث ة ال ولاد فيم ا يخ ص الحيوان ات البالغ ة وقل ة الرض اعة للعج ول الص غير وك ذل عان ت م ن الإس هال ال دموي أما الحيوانات المصابة ببكتريا ، والجفاف الشديدين ووجود مخاط سمي وكذل إرتفاع درجة الحرار فقد أعط ت أعراض ا C.lari تمثلت بالإسهال المائي والجفاف المعتدل وخيوط من المخاط ولا وجود للد في براز الحيوانات المصابة بالإسهال ا فض لا ع ن فق دان الش هية والخم ول وكان ت الح رار والن بن والت نفل ض من المع دل الطبيع ي. يمك ن أن نس تنتج ان الن وعين المع زولين م ن الأبق ار المصابة بالإس هال ( C.Coli و ) ي أن واع جدي د تض اف إل ى ن وعي الكمبايلوب اكتر C.lari C.fetus) و )المعزول ة C.Jejuni سابقا من الأبقار في العراق و ذا أدى إلى زياد مجموع أنواع الكمبايلوباكتر في العراق إلى أربعة أنواع

Table of content: volume:42 issue:1