research centers


Search results: Found 4

Listing 1 - 4 of 4
Sort by

Article
Prevalence of Candida Species and Oral Candidiasis during Menstrual Cycle in a Sample of Women in Baghdad City

Authors: Aws Waleed Abbas --- Rafil H. Rasheed --- Jasim M. Karhoot
Journal: Iraqi Academic Scientific Journal المجلة العراقية للاختصاصات الطبية ISSN: 16088360 Year: 2009 Volume: 8 Issue: 1 Pages: 73-78
Publisher: The Iraqi Borad for Medical Specialization المجلس العراقي للاختصاصات الطبية

Loading...
Loading...
Abstract

ABSTRACT:BACKGROUND:Menstrual cycle define and reflect the women internal endocrine environment. Ovarian hormones, estrogens and progesterone, are not secreted in constant amounts throughout the cycle. Estrogen and progesterone have been shown to inhibit aspects of both innate and acquired immunity at the systemic or local level furthermore they have been shown to influence on maturation and keratinization of oral mucosa. So there may be possible influence of the menstrual cycle on the adherence of Candida to human oral epithelial cells, and may implicate hormonal factors in the aetiology of oral Candidiasis.OBJECTIVE:The purpose of this study was to estimate the prevalence of Candida albicans and other different Candida species in the oral cavity during different periods of menstrual cycle.METHODS:One hundred and seventy six oral swabs were taken from 44 females’ patients attending dental clinic during the period from May to September2007 with age range 14-49 years old at different periods of menstrual cycle on days 5, 13, 22 and 28, which represent menstrual phase, ovulatory phase, mid-luteal phase and premenstrual phase respectively.Swabs were taken from the tongue for isolation of Candida species. The swabs were inoculated on Sabouraud’s glucose agar incubated at 37º for 72 hours; Candida species were identified by gram stain method, germ tube method and fermentation of sugar set.RESULTS:The prevalence of Candida in the oral cavity at 5th, 13th, 22nd and 28th days of menstrual cycle were 31.8%, 22.7%, 40.9% and 25% respectively. The study shows that the prevalence of Candida in the oral cavity was non-significantly higher at 22nd day of menstrual cycle.CONCLUSION:There was no significant influence of menstrual cycle on the prevalence of Candida in the oral cavity during different periods.The prevalence of Candida albicans was higher during different periods of menstrual cycle in comparison to Candida tropicalis and Candida parapsilosis


Article
Isolation and Identification of Isolation and Identification of Isolation and Identification of Isolation and Identification of Isolation and Identification of Isolation and Identification of Isolation and Identification of Isolation and Identification of Malassezia Malassezia Malassezia Malassezia Species in Patients Species in Patients Species in Patients with Pityriasis Versicolorwith Pityriasis Versicolor with Pityriasis Versicolor with Pityriasis Versicolorwith Pityriasis Versicolor with Pityriasis Versicolor with Pityriasis Versicolorwith Pityriasis Versicolorwith Pityriasis Versicolorwith Pityriasis Versicolor with Pityriasis Versicolor with

Authors: Jasim M. Karhoot --- Adil A. Noaimi --- Warkaa F. Ahmad
Journal: Iraqi Academic Scientific Journal المجلة العراقية للاختصاصات الطبية ISSN: 16088360 Year: 2012 Volume: 11 Issue: supplement Pages: 724-730
Publisher: The Iraqi Borad for Medical Specialization المجلس العراقي للاختصاصات الطبية

Loading...
Loading...
Abstract

ABSTRACT:BACKGROUND:Malassezia are unipolar yeasts that comprised from eleven species and recognized as commensally skin flora that may be pathogenic under certain conditions.OBJECTIVE:To isolate and identify different species of Malassezia in Iraqi patients with pityriasis versicolor.MATERIALS AND METHODS:This case investigative study was done in Microbiology and Dermatology Departments, College of Medicine, University of Baghdad- Baghdad, Iraq during the period from April 2008 - October 2008.One hundred patients had pityriasis versicolor were evaluated regarding all points related to the disease. Wood's light and skin scraping for mycological examinations were done. Methylene blue stained samples were examined for the presence of clusters of yeasts, budding cells, and hypha. Tween assimilation and splitting of esculin tests were carried out.RESULTS:The most common isolated species were Malassezia globosa 40(51%), followed by Malassezia furfur 24(30%), Malassezia symbodialis 8(10%), Malassezia obtuse 5(6%) and Malassezia restricta2(3%).CONCLUSION:Malassezia globosa was the most predominant species involved in etiology of pityriasis versicolor lesions followed by Malassezia furfur.


Article
THE ROLE OF MATRIX METALLOPROTEINASE-2 AND -9 IN SITU HYBRIDIZATION IN BLADDER CANCER PROGRESSION

Authors: Alaa Gh Hussain علاء غني حسين --- Jasim M Karhoot جاسم محمد كرحوت --- Areej A Hussein اريج عطية حسين
Journal: IRAQI JOURNAL OF MEDICAL SCIENCES المجلة العراقية للعلوم الطبية ISSN: P16816579,E22244719 Year: 2011 Volume: 9 Issue: 3 Pages: 247-254
Publisher: Al-Nahrain University جامعة النهرين

Loading...
Loading...
Abstract

BackgroundTransitional cell carcinomas (TCC) of the bladder are a major health problem and can be a leading cause of death. There are several proteolytic enzymes which are responsible for the degradation of the extra cellular components and have an essential role in tumor invasion and metastasis. MMP-2 and MMP-9 are the most important class of these enzymes.ObjectiveTo assess the In situ hybridization expression of MMP-2 and MMP-9 in TCC of the bladder.MethodsFifty formalin fixed, paraffin embedded of TCC of the bladder tissue blocks from Specialized Surgical Hospital in Baghdad, were included in this study. In addition ten apparently normal bladder autopsies were collected from the Forensic Medicine Institute Archives used as control group. Tissue blocks were sectioned on charged slides to be used for In situ hybridization, for the detection of MMP-2 and MMP-9.ResultsThe expression of MMP-2 and MMP-9 in TCC of the bladder tissues in the present study was 64 % for both and strong relationship between expression of MMP-2 and MMP-9 and TCC of the bladder was detected.ConclusionMMP-2 and MMP-9 play an important role in progression of transitional cell carcinoma of the bladder. Key wordsBladder cancer, Matrix Metalloproteinases, invasion, metastasis, carcinogenesis.


Article
Identification Of Trichophyton rubrum Using Polymerase Chain Reaction
تشخیص الفطر ترایكوفایتون روبرم بأستخدام تفاعل البلمرة المتسلسل

Loading...
Loading...
Abstract

Trichophyton rubrum is an anthropophilic dermatophyte that is distributed worldwide and causes common cutaneous disease such as mycosis . Although several properties of this fungus have been investigated so far , however , a few studies were carried out in the field of molecular biology of this fungus .In the present study the application of PCR fingerprinting was performed using two primers : forward 5'TGGTCTGGCCTTGACTGACC3' and Reversed 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' for the purpose of species identification .Trichophyton rubrum isolates obtained from either human patients (5 isolates) and animals ( 5 isolates ) with dermatophytosis were prospectively isolated by cultures and identified on morphological basis at Baghdad University , Department of Dermatology , College of Medicine and College of Veterinary Medicine respectively from the period September 2010 till March 2011 .Trichophyton rubrum isolates were subjected to DNA extraction .Conventional PCR was done with Trichophyton rubrum specific primers 5 ' TGGTCTGGCCTTGACTGACC 3 ' and 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' .Six isolates were positive for DNA extraction .A single band corresponding to Trichophyton rubrum was obtained .The results of current study suggest that PCR is simple , rapid and sensitive method for diagnosis of dermatophyte infections .

تعتبر الترايكوفايتون روبرم من الفطريات المحبة للبشر متوزعة في العالم وتسبب الاصابات الفطرية الجلدية مثل المايكوسس . وبالرغم من ان هذة الصفات العديدة لهذا الفطر تم التحري عنها ولكن هنالك دراسات قليلة اجريت في حقل البايولوجي الجزيئي في هذا المجال .في هذة الدراسة تم استخدام فحص البلمرة المتسلسل بوجود نوعان من البرايمير : الاول: 5 ' TGGTCTGGCCTTGACTGACC 3 'والثاني : 5 ' GTAAGGATGGCTAGTTAGGGGG 3 'لغرض التشخيص .تم الحصول على خمسة عزلات مأخوذة من الانسان وخمسة عزلات من الحيوانات حيث تم تشخيصها بواسطة الزرع الفطري في شعبة الامراض الجلدية/ كلية الطب /جامعة بغداد وكلية الطب البيطري /جامعة بغداد بالتسلسل للفترة من ايلول /2010 ولفاية أذار /2012 وقد اخضعت هذة العزلات الى استخلاص DNA مع أستخدم تفاعل البلمرة المتسلسل العادي وكانت ستة عزلات اعطت وجود DNA وتم تحديدها على شكل Band .هذة الدراسة تقترح بأن فحص تفاعل البلمرة المتسلسل هو بسيط ,وسريع وطريقة حساسة لتشخيص أصابات الفطريات الجلدية.

Listing 1 - 4 of 4
Sort by
Narrow your search

Resource type

article (4)


Language

English (4)


Year
From To Submit

2014 (1)

2012 (1)

2011 (1)

2009 (1)