research centers


Search results: Found 9

Listing 1 - 9 of 9
Sort by

Article
Dermatophytes isolated from dogs suspected of dermatophytosis in Baghdad City
الفطريات الجلدية المعزولة من الكلاب المصابة بالفطريات الجلدية من مدينة بغداد

Author: Sudad Jasim Mohammed سداد جاسم محمد
Journal: Diyala Journal For Pure Science مجلة ديالى للعلوم الصرفة ISSN: 83732222 25189255 Year: 2013 Volume: 9 Issue: 4 Pages: 61-66
Publisher: Diyala University جامعة ديالى

Loading...
Loading...
Abstract

Microsporum canis and Trichophyton mentagrophytes var. granulare are the two most common species of dermatophytes causing ringworm of dogs in Baghdad together accounting for( 83.33%) of the isolates. The other isolates are the geophilic dermatophytes Microsporum gypseum (11.9%) and Cladosporium spp.(4.7%).Two of the dog isolates were connected with human dermatophytosis, there are skin lesions among members of three owner families suffering from the same infections as their pets.

ان نوعي الفطريات Trichophyton mentagrophytes var.granulare, Microsporum canis من اغلب الانواع المسبب للقوباء الجلدية للكلاب في بغداد اذ كان مجموعها بنسبة 83.33 %. اما الانواع الاخرى فكانت من الفطريات الترابية Microsporum gypseum بنسبة11.9 % و Cladosporium spp. بنسبة 4.7 % . وقد وجد بأن ثلاثة افراد من مالكي الكلاب مصابين بنفس الفطريات المعزولة من حيوانتهم.


Article
Investigate the Microbial Load and Types of Preservatives Yogurt Available In Local Market.
التحري عن الحمولة الميكروبية والمواد الحافظة لانواع اللبن الرائب المتوفر في الاسواق المحلية.

Author: Sudad Jasim Mohammed سداد جاسم محمد
Journal: iraq journal of market research and consumer protection المجلة العراقية لبحوث السوق وحماية المستهلك ISSN: ISSN/ 20713894/ EISSN/25236180 Year: 2015 Volume: 7 Issue: 2 Pages: 214-225
Publisher: Baghdad University جامعة بغداد

Loading...
Loading...
Abstract

The aim of this study to investigate the microbial load and type of preservative for the types of yogurt available in the Iraqi market to ensure the safety of food provided to the consumer and protect through examining the types of yogurt from harmful bacteria as well as to contain ratios acceptable to yeasts and molds is to find out by comparing models curd careless Iraqi standard quality(ISQ) and see how they conform to these specifications have been collecting 12 brands of yoghurt types it was been (Kala, Activia 1, Activia 2, Mazia, Shelan, Aib, Mersin, Morsi, Al-Safi, Zabady, Zakho, Arbil). Bacteriological tests were conducted on samples of yogurt (total bacterial count, coliform count, counting yeasts and molds). The results showed that the total number of bacteria raised in the trademark (Kala) as total 33×510 cfu/g While the lowest number in the trademark (Mercy) as total 23×110 cfu/g .The highest number of coliform 2×310 cfu/g was in brand (Arbil), while the lowest number of these bacteria 6×110 cfu/g was in Mark (Mersin). In contrast there were no growth of this bacteria in the brand (Mercy) and (Al-Safi). The molds and yeast count were the highest 25×410 cfu/g in the brand (Mazia) ,while the lowest number of molds and yeasts in trademark (Mercy) as total 2×310 cfu/g. It was found that there were no preservative in all yogurt's samples by testing the presence of sodium benzoate.

الهدف من هذه الدراسة التحري عن الحمولة الميكروبية والمواد الحافظة لانواع اللبن الرائب المتوافرة في الاسواق المحلية العراقية والمستوردة للتاكد من سلامة الغذاء المقدم للمستهلك وحماية من خلال التاكد من خلو انواع اللبن الرائب من البكتريا الضارة فضلا عن احتواءها على نسب مقبولة من الخمائر والاعفان ويتم معرفة ذلك عن طريق مقارنه النماذج اللبن الرائب المدروسة ومدى مطابقتها للمواصفة القياسية العراقية، تم جمع 12 عينة من المنتجات اللبنية المتوافرة في الاسواق المحلية (كاله، اكتيفيا1، اكتيفيا2، مزايا، شيلان، اب، مرسين، مرسي، الصافي، زبادي، زاخو، اربيل)، تم اجراء الفحوصات البكتريولوجية لنماذج اللبن الرائب والتي شملت العد الكلي (للبكتريا، بكتريا القولون، الخمائر والاعفان). اظهرت نتائج الفحص البكتريولوجي ارتفاع العدد الكلي للبكتريا في العلامة التجارية (كاله) اذ كانت cfu/g 33×510 في حين بلغ اقل عدد لها في العلامة التجارية (مرسي) اذ كانت cfu/g 23×110، كما بلغ اعلى عدد لبكتريا القولون cfu/g 5×410 في العلامة التجارية (اربيل) في حين بلغ اقل عدد لهذة البكتريا cfu/g 6×110 في العلامة (مرسين)، بينما خلت العلامتان التجاريتان (مرسي) و (الصافي) من هذه البكتريا. تبين ان اعلى عدد للاعفان والخمائر cfu/g 25×410 في العلامة التجارية (مزايا)، اقل عدد للاعفان والخمائر في العلامة التجارية (مرسي) اذ كانت cfu/g 2×310. اظهرت نتائج الدراسة بخلو جميع المنتجات اللبنية المحلية والمستوردة من المواد الحافظة (بنزوات الصوديوم).


Article
Study The Bacterial Content Of The Local Pocessed Meat (Albastirma)
دراسة المحتوى البكتيري للحم المقدد المحلي (الباسطرمة)

Author: Sudad Jasim Mohammed سداد جاسم محمد
Journal: Diyala Journal For Pure Science مجلة ديالى للعلوم الصرفة ISSN: 83732222 25189255 Year: 2016 Volume: 12 Issue: 4 - part 1 Pages: 52-59
Publisher: Diyala University جامعة ديالى

Loading...
Loading...
Abstract

The aim of this study was carried out to investigate the microbial content of the bacon meat (Albastirma) which available in the Iraqi market to ensure the safety of food provided to the consumer protection by ensuring free meat cured of harmful bacteria as well as to contain the acceptable bacteria ratios by comparing the meat models bacon (Albastirma) nd the extent of compliance with the Iraqi standard specification. Elven bacon meat samples were collected From local markets in Baghdad city. Bacteriological tests were conducted including :Total count of bacteria, Fecal coliform counting, counting Staphylococcus, Salmonella .Results of bacteriological examinations reveal the total number of bacteria in the trademark (F8) total was 23×106 cfu/g and while the lowest number in the trademark (F10) total was 31 × 103 cfu / g, also reached the highest number of Coliform 23 × 103 cfu / g in the trademark (F2) while the fewest amount of this bacteria 11 × 102 cfu / g in Mark (F4), while deserted brands (F11, F10, F9, F6, F5 , F3, F1) of these bacteria. It shows that the highest number of Staphylococcus 14 × 104 cfu / g in the trademark (F2), less the number of Staphylococcus in the trademark (F11) total was 2 × 101 cfu / g. Salmonella spp. were detected in three brand namely (F2, F4 , F8) .

الهدف من هذه الدراسه التحري عن المحتوى الميكروبي للحم المقدد (الباسطرمة) والمتوافره في الاسواق العراقيه للتاكد من سلامه الغذاء المقدم للمستهلك والتاكد من خلو اللحوم المقددة من البكتريا الضاره فضلا عن احتواءها على نسب مقبوله من البكتريا ويتم معرفه ذلك عن طريق مقارنه النماذج اللحم المقدد (الباسطرمة) ومدى مطابقتها للمواصفة القياسية العراقية ,تم جمع 11 عينه من المنتجات اللحم المقدد المتوافره في الاسواق المحليه وبصورة عشوائية وبمواسم مختلفة , تم اجراء الفحوصات البكتريولوجيه لنماذج اللحم المقدد (الباسطرمة) والتي شملت العد الكلي للبكتريا , عد بكتريا القولون البرازية , عد المكورات العنقودية, السالمونيلا. اظهرت نتائج الفحص البكتريولوجي ارتفاع العدد الكلي للبكتريا في العلامه التجاريه (F8) اذ كانت cfu/g 23 × 610 في حين بلغ اقل عدد لها في العلامه التجاريه (F10) اذ كانت cfu/g 31 × 310 , كما بلغ اعلى عدد لبكتريا القولون cfu/g 23 × 310 في العلامه التجاريه (F2) في حين بلغ اقل عدد لهذة البكتريا cfu/g 11 × 210 في العلامه (F4) , في حين خلت العلامات التجارية (F11 ,F10 ,F9 ,F6 ,F5 ,F3 F1) من هذة البكتريا . تبين ان اعلى عدد للمكورات العنقودية cfu/g 14 × 410 في العلامه التجاريه (F2) , اقل عدد للمكوراتالعنقودية في العلامه التجاريه (F11) اذ كانت cfu/g 2 × 110 . وجدت السالمونيلا في ثلاثة علامات تجارية هي (F2 و F4 و F8) .


Article
A Survey of Dermatophytes Isolated from Cows and Sheep in Iraq
دراسة بحثية عن الفطريات الجلدية المعزولة من الابقار والاغنام في العراق

Authors: Mohammed K Faraj محمد قاسم فرج --- Sudad Jasim Mohammed سداد جاسم محمد
Journal: The Iraqi Journal of Veterinary Medicine المجلة الطبية البيطرية العراقية ISSN: 16095693 Year: 2011 Volume: 35 Issue: 2 Pages: 40-45
Publisher: Baghdad University جامعة بغداد

Loading...
Loading...
Abstract

A total of 100 animals were examined during the period of beginning of September - 2010 till the end of March 2011 at dept of Microbiology college of Veterinary Medicine Baghdad University Baghdad Iraq. These animals include 50 cow and 50 sheep. Hairs and scales were submitted to direct KOH mount smear and culture on modified Sabouraud's Dextrose agar medium The direct smear was positive in 40 ( 80%) for both cows and sheep while the growth of dermatophyte was positive in 35 ( 70%) and 38 ( 76%) for cows and sheep respectively. Species identification revealed the presence of Trichophyton rubrum ( 19 isolates ) Trichophyton verrucosum ( 10 isolates ) Trichophyton mentagrophytes ( 5 isolates ) and Microsporum canis ( one isolate ) in cow while Trichophyton rubrum (22 isolates) Trichophyton verrucosum ( 2 isolates ) and Trichophyton mentagrophytes ( 14 isolates) was recorded in sheep.

تم فحص مائة حالة من الابقار والاغنام خلال الفترة من بداية شهر أيلول 2010 الى نهاية شهر أذار 2011 وفحصت النماذج المأخوذة من الجلد والشعر في كلية الطب البيطري / جامعة بغداد. خضعت النماذج المأخوذة للفحص المباشر بأستخدام الشريحة المرطبة بمحلول هيدروكسيد البوتاسيوم ( (%10 KOHمع الزرع على وسط السابرويد المطور وكانت نتجة الفحص المباشر 40 (80%) لكل من الابقار بينما كان نمو الفطريات الجلدية موجبة في 35 (70%) و 38 ( 76%) للابقار والاغنام على التوالي. أظهر فحص تشخيص الانواع ففي الابقار وجود 19 عزلة للنوع Trichophyton rubrum 10عزلات نوع Trichophyto verrucosum و 5 عزلات للنوع Trichophyton mentagrophytesو عزلة واحدة للنوع Microsporum canis بينما في الاغنام شخصت 22 عزلة من النوع Trichophyton rubrum و عزلتان من النوع Trichophyton verrucosumو 14 عزلة من النوع Trichophyton mentagrophyte.


Article
Using of ELISA Technique for Detection the Supplement Effects of Eruca sativa Leaves in Human Males Hormones
استعمال تقانة الاليزا في الكشف عن تاثير تناول اوراق الجرجير في مستوى الهرمونات الذكرية

Authors: Sudad Jasim Mohammed سداد جاسم محمد --- Ibtisam Fareed Ali ابتسام فريد علي
Journal: Diyala Journal For Pure Science مجلة ديالى للعلوم الصرفة ISSN: 83732222 25189255 Year: 2015 Volume: 11 Issue: 4 Pages: 11-16
Publisher: Diyala University جامعة ديالى

Loading...
Loading...
Abstract

This study was carried out to investigated the effect of Eruca sativa fresh on fertility potential,testosterone and progesterone hormone in human male. Sixteen male human were randomly divided into 4 group, control, group A, group B, and group C. each group comprising of 4 male divided into four age period. At the end of treatment period blood testosterone and progesterone concentration were in ensured by ELISA methods. Significant difference in blood testosterone concentration was observed in male group compared to the control group. The result of this study showed that Eruca sativa fresh leaves especially in higher doses could increase testosterone concentration in male human.

قد أجريت هذه الدراسة للتحقق من تأثير اوراق نبات الجرجير الطازج على الخصوبة. وتاثيره على هرمون التستيرون و البروجسترون في الجنس الذكري )الانسان(.تم اختيار ستة عشر من الذكور وتم تقسيمهم بشكل عشوائي إلى 4 مجاميع، مجموعه السيطرة، مجموعة A ، مجموعة B ، ومجموعة C. كل مجموعة تتألف من 4 ذكور مقسمون الى اربع مراحل عمريه.في نهاية فترة العلاج تم قياس تركيز هرمون التستوستيرون في الدم وتركيز هرمون البروجسترون بطريقه ELISA .واظهر اختلاف كبير في تراكيز هرمون التستوستيرون في الدم ولوحظ ذلك في مجموعة الذكور مقارنة مع مجموعة االسيطره. وقد أظهرت نتائج هذه الدراسة أن تأثير اوراق نبات الجرجير وخاصة في الجرعات العالية يمكن أنيزيد تركيز هرمون التستوستيرون في ذكور الإنسان.


Article
Efficiency of Some Gel hand sanitizers Obtained From Iraqi local Markets.
تقييم فعالية بعض انواع مطهرات اليد الهلامية المتوافرة في الاسواق المحلية.

Loading...
Loading...
Abstract

The research aims to investigate the efficiency of waterless hand cleaners used by different sectors of society and in particular women and children as hygiene for hands to reduce the spread of infection. This is the first study was carried out in our Center for Market Research and Consumer Protection during the year (2013). Eleven samples of waterless hand cleaner were obtained from Iraqi local markets which subjected to the following studies: first the chemical analyses using Atomic absorption to estimate the concentration of (Cd, Pb, Co, Cu),second the Bacteriological examination which include to study the effect of these samples against bacteria including (E.coli, Bacillus spp.).The results showed that Kelobatra, Dettol contain high concentration of Copper (0.4398, 0.2768 μg /g) and lead (0.2033, 0.2287μg /g), while the rest of tested brands contained lowerconcentration of Copper and lead. Beauty and Dettol showed high concentration of Cobalt (0.0817, 0.0886 μg/g) respectively. Bacteriological examination reveals that 4wet and Cleaner samples had high efficiency against E.coli while Vanilla and Kelobatra showed no antibacterial activities against E.coli. 4 wet and Dettol had high efficiency against Bacillus spp. .

يهدف البحث إلى التحري عن فعالية غسول اليد الهلامية المستخدمة من قبل مختلف فئات المجتمع وبخاصة النساء والأطفال باعتبار نظافة الأيدي مهمة للحد من انتشار العدوى, وتم اجراء هذه الدراسه في مركز بحوث السوق وحماية المستهلك خلال سنه (2013). سحب احد عشر عينة من غسول اليد الهلامية من الأسواق المحلية وتم أجراء الفحص الكيميائي باستخدام جهاز الامتصاص الذري لتقدير تراكيز (الكادميوم، الرصاص، كوبالت، النحاس(. أما الفحص الثاني ويشمل الفحص البكتريولوجي والتي تشمل دراسة تأثير هذه العينات بما في ذلك تأثيرها ضد بكتريا ( Esherichia spp. Bacillus spp.) أظهرت النتيجة أن غسول اليد Kelobatra، Dettol تحتوي على تراكيز من النحاس (0.4398، 0.2768 ميكروغرام/ غرام) والرصاص (0.2033، 0.2287 ميكروغرام/ غرام) في حين أن العينات المختبرة الأخرى احتوت على تراكيز واطئه من النحاس والرصاص. اما غسول علامة,Beauty Dettol تظهر احتواءها على تراكيز عالية من الكوبالت (0.0817، 0.0886 ميكروغرام/ غرام) على التوالي. أما الفحص البكتريولوجي اظهر أن غسول 4wet وCleaner blue colour كانت ذات كفاءة مطابقة لما كتب على بطاقة الدلالة ولها كفاءة عالية ناهضت E.coli)) بينما Vanilla Kelobatra لم تظهر أي منطقة تثبيط لبكتريا القولون(E.coli). غسول 4wet و Dettol اظهرت كفائه عاليه لمناهضة .Bacillus spp .


Article
The Effect of Marketing for Indian Frozen Meat in the Local Market and Its Reflection on the Microbial Load
تاثير تسويق اللحوم الهندية المجمدة في الاسواق المحلية وانعكاسه على الحمولة الميكروبية

Authors: Salim Saleh Al- Timimi سالم صالح التميمي --- Sudad Jasim Mohammed سداد جاسم محمد --- Ibtsam Fareed Ali. ، ابتسام فريد علي
Journal: Iraqi Journal of Science المجلة العراقية للعلوم ISSN: 00672904/23121637 Year: 2014 Volume: 55 Issue: 4A Pages: 1517-1527
Publisher: Baghdad University جامعة بغداد

Loading...
Loading...
Abstract

This study aimed to investigate the Microbial Load of Indian Meat available in local market of Baghdad city to ensure that they are free from bacteria and to indicate the safety of product depending on the Iraqi standards. in addition to the estimation of some elements such as (Iron, Copper, Lead, Cadmium, Chrome) , we gathered 30 trade brands of meat included: (Khairat Karbala1,Khairat Karbala2, Thamarat Karbala1, Thamarat Karbala2, Alwakeel1, Alwakeel2, Anbar, Anwar Karbala, Alfakher, Alraudhatain, Almurad, Zamzam, Rayat, Karbala, Karbala, Alanna1,SAS,Alahmed,MKR,Altamam,Anwar,Almuntathr,Alwesam,Albayader,Ambar,Thamarat Karbala,Alhalal,Alanwar,Alhana,Alfakher,Alana2).the bacteriological test for these samples which included(total bacteria number, total coliform number, salmonella number, Staphylococcus bacteria number) were done. The result of study shows the increasing in the bacteria total number in (Alanwar ) which reached 410×28 cfc/g while less number was 110×28 cfc/g in (Almurad) brand. Also the highest number for Staphylococcus bacteria was 410×13 cfc/g found in (MKR) brand, while four brands (Anbar, Anwar Karbala, Alfakher) content on Salmonella and the others were free from it. As for coliform bacteria its number was between310×1 cfc/g - 310×15 cfc/g . the highest concentration for Iron 5.424µg/g in (Alana) brand and less concentration was 0.200µg/g in (Albayader) brand , the concentration of Cooper element was between 1.451µg/g - 0.001µg/g , while the highest concentration of Lead element 0.639µg/g in (Alwesam) brand . Both brands (Almurad, Albayader) were free from this element. The highest concentration of Cadmium appears in ( Thamarat Karbala 4, Alana1) reached 1.541µg/g while other brands were free from this element . According to Chrome the highest concentration appears in two brand ( Ambar,Alanwar) reached 0.045µg/g while less concentration appears in ( zamzam) brand reached 0.003µg/g ,other brands free from this element

هدفت الدراسة التحري عن المحتوى الميكروبي للحوم الهندية المتوافرة في الاسواق المحلية لمدينة بغداد للتاكد من خلوها من البكتيريا الضارة وسلامتها ومدى مطابقتها للمواصفات القياسية العراقية ، كما تم تقدير بعض العناصر المعدنية النزرة مثل ( الحديد , النحاس , الرصاص , الكادميوم , الكروم) تم جمع 30 علامة تجارية من هذه اللحوم شملت (خيرات كربلاء1 , خيرات كربلاء 2, ثمرات كربلاء 1, ثمرات كربلاء 2 , الوكيل1, الوكيل2, عنبر , انوار كربلاء, الفاخر, الروضتين, المراد, زمزم , راية كربلاء, كربلاء, الانة1, SAS , الاحمد , MKR, التمام, انوار المنتظر ,الوسام , المراد , البيادر , عمبر, ثمرات كربلاء , الحلال, الانوار, الهنا, الفاخر , الانة2). تم اجراء الفحوص البكتريولوجية على هذه النماذج والتي شملت (العددالكلي للبكتريا , عد بكتريا القولون الكلية , عد بكتريا السالمونيلا, عد بكتريا المكورات العنقودية). اظهرت نتائج ارتفاع العدد الكلي للبكتريا في العلامة (الانوار) اذ بلغ cfu/g 28×410 في حين بلغ اقل عدد لها cfu/g 22×110 في العلامة (المراد) ، كما بلغ اعلى عدد لبكتريا المكورات العنقودية cfu/g 13×410 في العلامة (MKR). واحتوت اربعة علامات هي (عنبر وانوار كربلاء والفاخر والانوار) على بكتريا السالمونيلا وخلت باقي العلامات منها. اما بكتريا القولون فقد تراوحت اعدادها ما بين cfu/g 15×310 - 1×310. بلغ اعلى تركيز لعنصر الحديد 5.424 µg/g في العلامة (الانة1) واقل تركيز له 0.200µg/g في العلامة (البيادر) ، وقد تراوح تركيز النحاس ما بين 1.451µg/g - 0.001µg/g. كما بلغ اعلى تركيز لعنصر الرصاص 0.639µg/g في العلامة (الوسام) في حين خلت العلامتين( المراد, البيادر) من هذا العنصر. وقد ظهر اعلى تركيز للكادميوم في العلامتين (ثمرات كربلاء3 و الانا1) اذ بلغ 1.541 µg/g في حين خلت معظم العلامات من هذا العنصر. اما بالنسبة لعنصر الكروم فقد ظهر أعلى تركيز له في العلامتين (عمبر والانوار) اذ بلغ 0.045 µg/g في حين بلغ اقل تركيز له في العلامة (زمزم) اذ بلغ 0.003 µg/g ، وقد خلت معظم العلامات الباقية من هذا العنصر.


Article
Identification Of Trichophyton rubrum Using Polymerase Chain Reaction
تشخیص الفطر ترایكوفایتون روبرم بأستخدام تفاعل البلمرة المتسلسل

Loading...
Loading...
Abstract

Trichophyton rubrum is an anthropophilic dermatophyte that is distributed worldwide and causes common cutaneous disease such as mycosis . Although several properties of this fungus have been investigated so far , however , a few studies were carried out in the field of molecular biology of this fungus .In the present study the application of PCR fingerprinting was performed using two primers : forward 5'TGGTCTGGCCTTGACTGACC3' and Reversed 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' for the purpose of species identification .Trichophyton rubrum isolates obtained from either human patients (5 isolates) and animals ( 5 isolates ) with dermatophytosis were prospectively isolated by cultures and identified on morphological basis at Baghdad University , Department of Dermatology , College of Medicine and College of Veterinary Medicine respectively from the period September 2010 till March 2011 .Trichophyton rubrum isolates were subjected to DNA extraction .Conventional PCR was done with Trichophyton rubrum specific primers 5 ' TGGTCTGGCCTTGACTGACC 3 ' and 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' .Six isolates were positive for DNA extraction .A single band corresponding to Trichophyton rubrum was obtained .The results of current study suggest that PCR is simple , rapid and sensitive method for diagnosis of dermatophyte infections .

تعتبر الترايكوفايتون روبرم من الفطريات المحبة للبشر متوزعة في العالم وتسبب الاصابات الفطرية الجلدية مثل المايكوسس . وبالرغم من ان هذة الصفات العديدة لهذا الفطر تم التحري عنها ولكن هنالك دراسات قليلة اجريت في حقل البايولوجي الجزيئي في هذا المجال .في هذة الدراسة تم استخدام فحص البلمرة المتسلسل بوجود نوعان من البرايمير : الاول: 5 ' TGGTCTGGCCTTGACTGACC 3 'والثاني : 5 ' GTAAGGATGGCTAGTTAGGGGG 3 'لغرض التشخيص .تم الحصول على خمسة عزلات مأخوذة من الانسان وخمسة عزلات من الحيوانات حيث تم تشخيصها بواسطة الزرع الفطري في شعبة الامراض الجلدية/ كلية الطب /جامعة بغداد وكلية الطب البيطري /جامعة بغداد بالتسلسل للفترة من ايلول /2010 ولفاية أذار /2012 وقد اخضعت هذة العزلات الى استخلاص DNA مع أستخدم تفاعل البلمرة المتسلسل العادي وكانت ستة عزلات اعطت وجود DNA وتم تحديدها على شكل Band .هذة الدراسة تقترح بأن فحص تفاعل البلمرة المتسلسل هو بسيط ,وسريع وطريقة حساسة لتشخيص أصابات الفطريات الجلدية.


Article
A Survey Of Dermatophytes Isolated From Iraqi Patients In Baghdad City

Loading...
Loading...
Abstract

Dermatophytes infection is a common problem worldwide and frequent in Iraq. Several reports and articles were published on prevalence, distribution, causes and treatment of dermatophytosis . This case study was conducted on fifty patients(31males and 19 females) with suspected dermatophytes were studied . Their ages ranged from one year to fifty years .Patients admitted to Baghdad Teaching Hospital , Dept . of Dermatology , Baghdad during September 2010 to March 2011.Hairs and scales were collected and microscopicall examination using 20% KOH were done. Hair and scales from active outer border of the lesion were inoculated on modified Sabouraud's dextrose agar. Culture was incubated at room temperature(28C°) for 4 - 5 weeks. The identification of dermatophyte species was based on the gross , and microscopical and cultural characteristic according to standard mycological references . The infection of dermatophyte was much higher in children below 10 years of age. Males 31(62%) were affected more than females 19(38%).Tinea capitis 19(47.5%) was the predominant clinical type .The main etiological agents was Trichophyton rubrum 20(50%) followed by Trichophyton mentagrophytes 13(32.5%). The predominant anthropophilic dermatophytic species was Trichophyton rubrum. This study was carried out to determine the prevalence, causative agents of dermatophytosis in group of Iraqi patients in Baghdad.

اصابات الامراض الجلدية من المشاكل الشائعة في العالم وخاصة العراق . عدة تقارير نشرت لدراستها وخاصة الانتشار والمسببات والمعالجة . وقد اجريت هذة الدراسة حيث تضمنت خمسون مريضا ( 31 ذكر مع 19 انثى ) المشكوك بأصابتهم بالفطريات .وترواحت اعمارهم من سنة واحدة الى خمسون سنة. المرضى من مراجعين لمستشفى بغداد التعليمي و شعبة الامراض الجلدية – في مدينة بغداد للفترة من بداية شهر أيلول 2010 وحتى نهاية شهر أذار 2011 . خضعت النماذج المأخوذة من الشعر والكشطات الجلدية الى الفحص المباشر بمحلول 20%KOH وقد زرعت على وسط السابرويد المطور وتحت درجة حرارة 28م ولمدة 4 -5 اسابيع. وقد شخصت الفطريات المسببة للامراض الجلدية بألاعتماد على الشكل المظهري للنمو الفطري والفحص المجهري لها والتفاعلات الكيموحيوية وبالاعتماد على المصادر الفطرية .وسجلت اعلى اصابة في الاطفال دون سن العاشرة من العمر وكانت اصابة الرجال 31 (62%) اعلى من النساء 19 (38%). الاصابة بسعفة الرأس( (Tinea capitisوالتي كانت سائدة أكثر من بقية الحالات الجلدية الاخرى حيث شكلت نسبة أصابة47.5 %.اما المسببات الرئيسية للاصابات الفطريات الجلدية في البشر هي: Trichophyton rubrum 20 عزلة ( (%50, Trichophyton menatgrophytes 13 عزلة (%32.5) , Microsporum canis 4 عزلة (%10) , Trichophyton sudanese 1عزلة(%2.5) , Trichophyton schoenleinii 1عزلة (%2.5) Epidermophyton floccosum and 1 عزلة (%2.5). واثبتت الدراسة ان الفطريات المحبة للبشرAnthropophilicهي السائدة.

Listing 1 - 9 of 9
Sort by
Narrow your search

Resource type

article (9)


Language

English (5)

Arabic (3)

Arabic and English (1)


Year
From To Submit

2016 (1)

2015 (3)

2014 (3)

2013 (1)

2011 (1)