research centers


Search results: Found 37

Listing 1 - 10 of 37 << page
of 4
>>
Sort by

Article
Identification Of Trichophyton rubrum Using Polymerase Chain Reaction
تشخیص الفطر ترایكوفایتون روبرم بأستخدام تفاعل البلمرة المتسلسل

Loading...
Loading...
Abstract

Trichophyton rubrum is an anthropophilic dermatophyte that is distributed worldwide and causes common cutaneous disease such as mycosis . Although several properties of this fungus have been investigated so far , however , a few studies were carried out in the field of molecular biology of this fungus .In the present study the application of PCR fingerprinting was performed using two primers : forward 5'TGGTCTGGCCTTGACTGACC3' and Reversed 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' for the purpose of species identification .Trichophyton rubrum isolates obtained from either human patients (5 isolates) and animals ( 5 isolates ) with dermatophytosis were prospectively isolated by cultures and identified on morphological basis at Baghdad University , Department of Dermatology , College of Medicine and College of Veterinary Medicine respectively from the period September 2010 till March 2011 .Trichophyton rubrum isolates were subjected to DNA extraction .Conventional PCR was done with Trichophyton rubrum specific primers 5 ' TGGTCTGGCCTTGACTGACC 3 ' and 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' .Six isolates were positive for DNA extraction .A single band corresponding to Trichophyton rubrum was obtained .The results of current study suggest that PCR is simple , rapid and sensitive method for diagnosis of dermatophyte infections .

تعتبر الترايكوفايتون روبرم من الفطريات المحبة للبشر متوزعة في العالم وتسبب الاصابات الفطرية الجلدية مثل المايكوسس . وبالرغم من ان هذة الصفات العديدة لهذا الفطر تم التحري عنها ولكن هنالك دراسات قليلة اجريت في حقل البايولوجي الجزيئي في هذا المجال .في هذة الدراسة تم استخدام فحص البلمرة المتسلسل بوجود نوعان من البرايمير : الاول: 5 ' TGGTCTGGCCTTGACTGACC 3 'والثاني : 5 ' GTAAGGATGGCTAGTTAGGGGG 3 'لغرض التشخيص .تم الحصول على خمسة عزلات مأخوذة من الانسان وخمسة عزلات من الحيوانات حيث تم تشخيصها بواسطة الزرع الفطري في شعبة الامراض الجلدية/ كلية الطب /جامعة بغداد وكلية الطب البيطري /جامعة بغداد بالتسلسل للفترة من ايلول /2010 ولفاية أذار /2012 وقد اخضعت هذة العزلات الى استخلاص DNA مع أستخدم تفاعل البلمرة المتسلسل العادي وكانت ستة عزلات اعطت وجود DNA وتم تحديدها على شكل Band .هذة الدراسة تقترح بأن فحص تفاعل البلمرة المتسلسل هو بسيط ,وسريع وطريقة حساسة لتشخيص أصابات الفطريات الجلدية.


Article
Cloning and Expression of Staphylokinase gene produced from Staphylococcus aureus in E. coli DH5α
كلونة وتعبير جين Staphylokinase المنتج من بكتريا Staphylococcus aureus في بكتريا E. coli DH5α

Authors: H. K. Buniya حارث كامل بنية --- H. A. Farhan حسن عطية فرحان
Journal: Al-Anbar Journal of Veterinary Sciences مجلة الانبار للعلوم البيطرية ISSN: 19996527/27070603 Year: 2016 Volume: 9 Issue: 2 Pages: 7-14
Publisher: University of Fallujah جامعة الفلوجة

Loading...
Loading...
Abstract

We selected two local bacterial isolated (A2 and A5) for Stahylococcus aureus according its high ability to produce Staphylokinase. The Chromosomal DNA isolated and used as a template to amplified sak gene. By polymerase Chain Reaction (PCR) we obtained 490 base pair DNA fragment, and ligated with linearized pRSETA cloning vector to produced pRSETA-sak recombinant DNA. The ligation products were transformed into E. coli DH5α. sak gene successful to produced target protein and gave positive result in caseinolytic assy. Then using Extracted DNA plamid as a template to amplified sak gene again

انتخبت العزلتان المحليتان (A2 وA5) من بين 12 عزلة من بكتريا المكورات العنقوديةStaphylococcus aureus لقدرتها العالية على انتاج بروتين الستافلوكاينييز. تم عزل الدنا الكروموسومي للعزلات المنتخبة واستخدم كقالب لبناء الجين sak. واستخدمت تقنية تفاعل البلمرة المتسلسل PCR في الحصول على قطعة دنا بحجم 490 زوج قاعدي. تم ربط قطعة الدنا على ناقل الكلونة pRSETA باستخدم انزيم T4 DNA Ligase للحصول على قطعة الدنا الهجينة pRSETA-sak ثم ادخالها الى السلالة E. coli DH5α بطريقة التحول الوراثي. نجح الجين sak في التعبير داخل الخلايا المتحولة وانتاج بروتين Staphylokinase بعد الحصول على نتيجة موجبة لاختبار الكازئيين اضافة الى استخادم الدنا البلازميدي المستخلص من السلالة المتحولة كقالب لبناء الجين sak مرة اخرى


Article
Molecular Heterogeneity of the Growth Hormone Gene and the Study of some Hormonal Changes for Individuals with Growth Hormone Deficiency
التغاير الجزيئي لجين هرمون النموGrowth Hormone Gene ودراسة بعض المتغيرات الهرمونية للأفراد الذين يعانون من نقص هرمون النمو

Loading...
Loading...
Abstract

This study was conducted to measure a group of hormones related with infected individuals with the shortage of the growth hormone by studying 150 patients in comparison with 50 samples taken from normal individuals as a control group. The study included investigation GH gene via polymerase chain reaction technology (PCR) by two primers designed specifically for this study (GH3, GH4). The results showed that mutations occurred in 12 individuals from the samples, 8% for GH3 , whereas the GH4 showed no absence or disorder in the sequence of bases. The results of Sequencing using the Blast program showed appearance of many mutations of deletion mutations and insertion mutations , and substitution mutations of two types of transition and transversion. The concentration of hormones has been measured were human Testosterone hormone , Prolactin hormone ,Cortisol hormone ,The results showed a highly significant differences in the levels of the averages of hormonal analysis , as well as a significant decrease in the average length of individuals and high moral appeared in body mass index(BMI) under the moral under the moral level of P ≤ 0.05.

شملت الدراسة الحالية150 فرد مصاب بنقص هرمون النمو من المراجعين لوحدة هرمون النمو في مستشفى الرمادي التعليمي للنسائية والاطفال في مدينة الرمادي ، وتراوحت أعمارهم بين 1- 18 سنة ، وقورنت العينات المدروسة مع 50 عينة من أفراد طبيعيين كمجموعة سيطرة ، تمت فحوص الوراثة الجزيئية بإستعمال تقنية تفاعل البلمرة المتسلسلة (PCR) للأفراد المصابين بنقص هرمون النمو وبواقع بادئين أُعدت خصيصا ً لهذه الدراسة واخذت الاسماء (GH4,GH3)وتبين حدوث الطفرات في 12فرد(8%) لـGH3 ،أما البادئ GH4 فلم يُسجل أي طفرة ، في حين لم تُظهر مجموعة السيطرة أي غياب للحزم، أظهرت نتائج الكشف عن تسلسلات القواعد النتروجينيةSequencing بالمقارنة بالتتابعات القياسية بإستخدام برنامج Blast إن العينات قيد الاختبار تحوي على طفرات متنوعة قسم منها طفرات حذف Deletion Mutations والقسم الاخر طفرات إضافة Mutations Addition وظهرت كذلك وبكثرة طفرات استبدال Substitution Mutations بنوعيها المكافئ Transition وغير المكافئ Transversion ،تم قياس مستوى تراكيز الهرمونات Testosterone Hormone ، Prolactin Hormone ، Cortisol Hormone ، وأظهرت الدراسة وجود اختلافات معنوية عالية في الاختبارات الهرمونية ، كذلك ظهر انخفاض معنوي في معدل طول الافراد وارتفاع معنوي في معدل كتلة الجسم BMI تحت مستوى معنوية( (P ≤ 0.05


Article
Molecular identification of Pseudomonas aeruginosa lectins (LecA and LecB) by using polymerase chain reaction
التشخيص الجزيئي للكتينات بكتريا Pseudomonas aeruginosa and LecB) LecA ( باستخدام تفاعل البلمرة المتعدد

Loading...
Loading...
Abstract

One hundred fifty-two (152) clinical samples included burns, otitis, and wounds samples and were collected from some Baghdad hospitals. About cystic fibrosis samples, 6 samples were obtained from postgraduate students in Institute of Genetic Engineering. Also, 67 environmental samples were collected. After isolation and identification, 83 isolates of Pseudomonas aeruginosa had been identified. Fifty-four (54) isolates, includes 44 clinical isolates and 10 eco isolates, were selected to investigate the Susceptibility Test toward 11 types of antibiotics. 35 isolates were selected for the discovering tests of 16S rRNA , LecA and LecB gene. Indeed, the bacterial isolates exhibited a high resistance against Ampicillin, Amoxicillin and Nalidixic acid; then decreased against Cefotaxime, Ceftazidimim, Tetracycline, Amikacin, Augmantin, Vancomycin, and Chloramphenicol, while the antibiotic Imipenem recorded a low resistance . The results of electrophoresis for PCR productions of gene 16S rRNA, which considered identification gene, showed peaks in the suspected size (956 bp) in all clinical and environmental isolates. The results of electrophoresis for the detection of LecA gene , LecB bands in the size of (369 and 226 base pairs) respectively for all isolates . From another hand, these results showed peaks for LecA and LecB genes with sizes 369 and 226 pb respectively for all clinical and environmental isolates.

جمعت 152 عينة سريرية شملت عينات الحروق والتهاب الاذن والجروح من بعض مستشفيات بغداد ، اما عزلات التليف الكيسي فقد حصل عليها من طلبة الدراسات العليا في معهد الهندسة الوراثية وعددها (6) وكما جمعت 67 عينة بيئية ، وبعد العزل والتشخيص تم الحصول على 83 عزلة من بكتريا Pseudomonas aeruginosa . اختيرت بشكل عشوائي 54 عزلة شملت 44 عزلة سريرية و10 عزلات بيئية لاجراء اختبار الحساسية تجاه 11 نوع من المضادات الحيوية واختيرت 35 عزلة اعتماداً على اختبار الحساسية لاجراء اختبارات الكشف عن جينات16S rRNA , LecA و LecB ، اذ اظهرت العزلات مقاومة عالية لمضادات Ampicillin , Amoxicillin و Nalidixic acid بلغت 94% , %90.7, %92.5 على التوالي ثـم تـدرجت مــقاومة البكــتريا لمــضادات Cefotaxime , Ceftazidimim , Tetracycline , Amikacin, Augmantin , Vancomycin و Chloramphenicol في حين كانت نسبة المقاومة منخفضة لمضادImipenem بلغت %22.2. اظهرت نتائج الترحيل الكهربائي لنواتج تفاعل البلمرة المتسلسل لجين ( (16S rRNA الذي يعتبر جيناً تشخيصياً حزماً ضمن الحجم المتوقع للجين (956 زوج قاعدي ) ولجميع العزلات السريرية والبيئية ، كما اظهرت نتائج الترحيل الكهربائي للكشف عن جينات LecA و LecB حزماً بحجم (369 و 226 زوج قاعدي) على التوالي ولجميع العزلات السريرية والبيئية .


Article
Comparison of Classical and Molecular Identification for Tannerella forsythia from Chronic Periodontitis Infections
مقارنة للتشخيص التقليدي والجزيئي لأفراد النوع Tannerella forsythia من إصابات ما حول الأسنان المزمنة

Author: Sahira I. AL-Sanjary ساهرة إدريس حميد السنجري
Journal: Rafidain journal of science مجلة علوم الرافدين ISSN: 16089391 Year: 2012 Volume: 23 Issue: 1A Pages: 79-90
Publisher: Mosul University جامعة الموصل

Loading...
Loading...
Abstract

The study included (48) Chronic Periodontitis samples were collected from both sexes with ages between (20-60) years, in addition to determination the average of pocket depth. Morphological and Classical characteristics of Tannerella forsythia using light and fluorescent microscopy were carried , in addition to biochemical tests. The species shown to be catalase and indol negative and without acid from glucose but Esculin hydrolysis test was positive while no growth was noted on esculin bile salt medium. DNA was extracted from Tannerella forsythia using the boiling method approximately (5.2-6.5) µg/ µl was obtained with (1.6-1.8) purity. polymerase chain reaction using species specific primer to amplify 641bp fragment from 16SrRNA gene was performed. It was found to be a more effective method for the detection of Tannerella forsythia in clinical specimen as it gave (43.7) positive isolates compared with (20.8) by using conventional methods.

شملت الدراسة (48) عينة من جيوب اللثة المصابة بالتهاب أنسجة ما حول الأسنان المزمنة Chronic periodontitis من كلا الجنسين وبأعمار مختلفة (60-20) سنة بالإضافة إلى تحديد معدل عمق الجيب. اعتمدت الصفات الشكلية والزرعية لأفراد النوع Tannerella forsythia باستخدام المجهر الضوئي والمجهر المتألق بالاضافة لبعض الفعاليات الانزيمية واظهر النوع نتائج سالبة لاختبار Catalase والاندول وإنتاج حامض من تخمر سكر الكلوكوز إلا أن أفراد النوع حللت الاسكولين ولم تستطع النمو على وسط Esculine-bile salt medium. عزل الـ DNA باستخدام طريقة الغليان Boiling method من جراثيم Tannerella forsythia اذ تراوحت كميته من (6.5-5.2 ) مايكروغرام / مايكروليتر وبنقاوة (1.8-1.6) كما أبدت تقنية الـ PCR كفاءة اكبر في الكشف عن تواجد جراثيم Tannerella forsythia من العينات السريرية مقارنة بالطرائق التقليدية, اذ تم الكشف عن جراثيم Tannerella forsythia بنسبة (20.8%) من العينات باستخدام الطرائق التقليدية فيما ارتفعت النسبة إلى (43.7%) باعتماد تقنية الـ PCR باستخدام بادئ متخصص لتضخيم القطعة bp 641 من الجين 16SrRNA.


Article
Molecular Diagnosis of Chronic Myeloid Leukemia & Monitoring Response to Different Types of Treatment
التشخيص الجزيئي لابيضاض الدم النقياني المزمن بواسطة تفاعل البلمرة الكمي المتسلسل و تقييم الاستجابة للعلاجات المختلفة

Loading...
Loading...
Abstract

Chronic myeloid leukemia (CML) is one of leukemia types which account for 15 % to 20% of all leukemia cases. Patients are presented with splenomegaly, fever, anemia, fatigue, weight loss, and weakness. It is results from reciprocal translocation (9; 22).This abnormality is called Philadelphia (Ph) chromosome and it is detected in 95% of patients with CML, and in 20% of patients with Acute Lymphocytic Leukemia (ALL). "Imatinibmesylate” is the most widely used drug for CML treatment because it targets the abnormal fusion gene. Blood samples were collected from (39) CML patients (19 males and 20 females) from July - November 2009 in The NationalCenter of Hematology/Baghdad. The age range were(8 – 70) years. According to the real time PCR results; the patients were divided into four groups: 1) PCR negative group. 2) PCR positive group on Hydroxyurea treatment 3) PCR positive group on Gleevec® treatment 4) PCR positive group with no treatment (recently diagnosed).Patients were selected randomly. Their RNA was extracted from peripheral blood cells and reverse transcribed into cDNA which was amplified using real time PCR to measure the ratio of BCR-ABL fusion gene in their Philadelphia chromosome. This is to confirm the diagnosis and evaluate the response to the most widely used drugs for CML treatment (Gleevec® 400 mg/d and hydroxyurea 450 mg/d for two months at least). This study excluded CML diagnosis in 10 patients, so other myeloproliferative disorders need to be verified. The group treated with Gleevec® showed a better response than hydroxyurea at the molecular level.Key words: leukemia, chronic myeloid leukemia, polymerase chain reaction, real time PCR, BCR-ABL, quantitative PCR, hydroxyurea, imatinibmesylate, Philadelphia chromosome, tyrosine kinase.

ابيضاض الدم النقياني المزمن هو أحد أنواع سرطانات الدم وهذا المرض مسؤول عن 15-20% من حالات اللوكيميا لدى البالغين. يعاني المرضى من تضخم الطحال و الحمى وفقر الدم والتعب وفقدان الوزن والضعف.ينتج المرض من تبادل بين الكروموسومين (9 ،22) . يسمى هذا الشذوذ كروموسوم فيلادلفيا و هو موجود في 95% من المرضى المصابين بإبيضاض الدم النقياني المزمن و20% من المرضى المصابين بإبيضاض الدم اللمفاوي الحاد.عقار اماتنيب مزيلات (كليفك) هو الأكثر إستعمالاً لعلاج ابيضاض الدم النقياني المزمن لأنه يستهدف المورثة غير الطبيعية.جمعت عينات الدم من 39 مريضاً(19 ذكر و 20 انثى) خلال الفترة الممتدة من تموز الى تشرين الثاني عام 2009 في المركز الوطني لبحوث وعلاج أمراض الدم في بغداد.تراوحت أعمار المرضى من 8 الى 70 سنة. تم توزيع المرضى الى اربع، مورثةBCR-ABL مجموعات وذلك حسب نتائج تفاعل البلمرة التسلسل:المجموعة الاولى: نتيجة سلبيةالمجموعة الثانية: نتيجة ايجابية وعلى علاج الهايدروكسي يورياالمجموعة الثالثة: نتيجة ايجابية وعلى علاج كليفكالمجموعة الرابعة: نتيجة ايجابية و بدون علاجتم اختيار المرضى بصورة عشوائيه وتم استخلاص الحامض النووي الرايبوسومي(RNA) من خلايا الدم وتحويله الى الحامض النووي الرايبوسومي منقوص الاوكسجين المستنسخ (cDNA)ومن ثم تكراره بأستعمال جهاز تفاعل البلمرة المتسلسل لاحتساب نسبة BCR-ABL في خلايا الدم وذلك لتأكيد تشخيص المرض ولتقييم استجابه الخلايا السرطانيه لعقاري الكليفك بجرعه 400 ملغم يوميا و الهيدروكسي يوريا بجرعه 450 ملغم يوميا وهما العقاران الاكثر شيوعا في علاج هذا النوع من السرطانات .اظهرت هذه الدراسه أن 10 مرضى من المجموع الكلي (39) غير مصابين بأبيضاض الدم النقياني المزمن وتوجب هنا البحث عن ما اذا كانوا مصابين بمرض آخر من مجموعه أمراض اضطرابات التكاثر النقوي . في حين تم تقسيم المرضى (29) والذين تم تأكييد اصابتم بأبيضاض الدم النقياني المزمن الى مجاميع حسب نوع العقار المستخدم فمجموعه حديثه التشخيص لم تتسلم أي علاج قبيل أجراء الدراسه ومجموعتين أخر تناولت عقاريين مختلفين لفترة لا تقل عن الشهرين لكل عقار (عقار الكليفك وعقار الهيدروكسي يوريا ) . سريريا وخلويا أظهرت المجموعتين استجابه فعاله للعقارين ، في حين بدى ان المجموعه التي استعملت عقار الكليفك كعلاج أعطت نتائج أفضل على المستوى الجيني ( بعد فحص نسبة الجين بجهاز البلمرة المتسلسل الكمي ) .


Article
GENOTYPING OF HLA-CLASS-I BY PCR-SSP OF IRAQI BREAST CANCER PATIENTS
التنميط الوراثي لمستضدات الخلايا البيض البشرية-الصنف الأول بواسطة تفاعل البلمرة المتسلسل – بتقنية الباديء المعين لسلسلة جينية معينة لمريضات سرطان الثدي العراقيات

Loading...
Loading...
Abstract

Background: The aetiology of breast cancer is multifactorial, in which genetic predisposition; environmental factors, hormones and even the infectious agents are thought to interact in the manifestation of disease. In this regard, alleles of HLA are important immunogenetic risk factors, but their associations show different frequencies in different populations.Objectives: This study was established to shed light on the possible association of HLA class I alleles with BC in Iraqi female patients.Subjects and Methods: The study included 60 subjects: 30 breast cancer patients, 12 patients with benign breast lesions as first control and 18 apparently healthy subjects as second control. Polymerase chain reaction-specific sequence primers (PCR- SSP) assay was conducted to assess HLA- typing.Results: Out of 95 HLA class I alleles (A= 24; B= 48; C= 23), one allele (HLA- A*03010101-07, 09-11N, 13-16 allele) showed a significant variation between breast cancer patients and control groups (healthy and disease controls) (50% vs. 16.6%, OR=5, EF= 0.40, P= 0.041), (50% vs. 8.3%, OR=11, EF=O.45, P=0.024) respectively.Conclusions: The results demonstrated that HLA- A*03010101-07, 09-11N, 13-16 allele may played a role in the etiology of the disease. Keywords: Breast cancer, HLA, PCR.

خلفية الدراسة : إن مسببات سرطان الثدي متعددة, فالمهيئات الوراثية ,العوامل البيئية والهرمونية وحتى الخمجية يعتقد بأنها تتداخل لإظهار المرض. في هذا الخصوص, أليلات مستضدات خلايا الدم البيض البشرية تعتبر مهمة كعوامل وراثية مناعية خطرة لكن مصاحبتها للمرض تظهر تكرارية مختلفة باختلاف الشعوب .هدف الدراسة: نظمت هذه الدراسة لتسلط الضوء على احتمالية وجود مصاحبة بين أليلات مستضدات خلايا الدم البيض البشرية )الصنف الأول( مع سرطان الثدي في المريضات العراقيات.الأشخاص وطرائق العمل: تضمنت الدراسة 60 شخص: 30 مريضة مصابة بسرطان الثدي, 12 مريضة مصابة باورام الثدي الحميدة كمجموعة ضابطه أولى و 18 امرأة سليمة ظاهريا كمجموعة ضابطه ثانية. استخدم فحص تفاعل البلمرة المتسلسل – بتقنية الباديء المعين لسلسلة جينية معينة لتقييم تنميط أليلات مستضدات الخلايا البيض البشرية.النتائــج: من 95 أليل لمستضدات خلايا الدم البيض البشرية الصنف الأول, أليل واحد (A*03010101-07,09-11N,13-16) اظهر تباين معنوي بين المريضات والمجموعتين الضابطتين (مجموعة النساء السويات ومجموعة مريضات أورام الثدي الحميدة) (50% vs. 16.6%, OR=5, EF= 0.40, P= 0.041), (50% vs. 8.3%, OR=11, EF=O.45, P=0.024) نسبة إلى كل منهما.الاستنتاجات: النتائج أظهرت بان الاليل: (A*03010101-07,09-11N,13-16) ربما لعب دور في أحداث المرض. مفتاح الكلمات: سرطان الثدي،مستضدات الخلايا البيض البشرية ، تفاعل البلمرة المتسلسل.


Article
GENOTYPING OF HLA-CLASS-II BY PCR-SSP OF IRAQI BREAST CANCER PATIENTS
التنميط الوراثي لمستضدات الخلايا البيض البشرية-الصنف الثاني بواسطة تفاعل البلمرة المتسلسل – بتقنية الباديء المعين لسلسلة جينية معينة لمريضات سرطان الثدي العراقيات

Loading...
Loading...
Abstract

Background: Breast cancer incidence differs among women of different racial/ethnic groups. Several HLA alleles are associated with susceptibility or protection in Breast cancer, the particular allele varies depending on the racial groups.Objectives: This study was established to shed light on the possible association of HLA class II alleles with BC in Iraqi female patients.Subjects and Methods: The study included 60 subjects: 30 breast cancer patients, 12 patients with benign breast lesions as first control and 18 apparently healthy subjects as second control. Polymerase chain reaction-specific sequence primers (PCR- SSP) assay was conducted to assess HLA- typing.Results : A survey of the distribution of HLA-DR and HLA-DQ alleles frequencies yielded no evident of positive association between class II alleles and BC as compared with both control groups, but there was appreciable significant decrease in the frequency of DR*010101,0102,0201-0204,04-13 and DQB1*0401,02 alleles in BC patients as compared with healthy control (P=0.031).Conclusions: These findings demonstrated that HLA– DR*010101, 0102, 0201-0204, 04-13 and DQB1*0401, 02 alleles may confer protective effects against BC. Keywords: Breast cancer, HLA allele, PCR.

خلفية الدراسة : إن نسبة حدوث سرطان الثدي في النساء يختلف باختلاف العرق او القومية. العديد من اليلات مستضدات الخلايا البيض البشرية لها علاقة بالاستعداد او الحماية من سرطان الثدي, خصوصية الاليل تختلف حسب العرق.هدف الدراسة : نظمت هذه الدراسه لتسلط الضوء على احتمالية وجود مصاحبة بين اليلات مستضدات خلايا الدم البيض البشرية )الصنف الثاني( مع سرطان الثدي في المريضات العراقيات.الاشخاص وطرق العمل : تضمنت الدراسة 60 شخص: 30 مريضة مصابة بسرطان الثدي, 12 مريضة مصابة باورام الثدي الحميدة كمجموعة ضابطه اولى و 18 امراة سليمة ظاهريا كمجموعة ضابطه ثانية. استخدم فحص تفاعل البلمرة المتسلسل – بتقنية الباديء المعين لسلسلة جينية معينة لتقييم تنميط اليلات مستضدات الخلايا البيض البشرية. النتائــج : أظهرت معاينة التوزيع التكراري لاليلات مستضدات الخلايا البيض البشرية-الصنف الثاني عدم وجود مصاحبة موجبة بين هذه الاليلات ومرض سرطان الثدي عند المقارنة مع مجموعتي السيطرة, لكن هناك نقصان مهم معنويا في تكرارية الاليلين:DR*010101, 0102, 0201-0204, 04-13 and DQB1*0401, 02 في مرضى سرطان الثدي مقارنة بالسيطرة الاصحاءالاستنتاجات: أظهرت النتائج بان الاليلين: DR*010101,0102,0201-0204,04-13 and DQB1*0401,02ربما تمنح الحماية من المرض.مفتاح الكلمات: سرطان الثدي، مستضدات الخلايا البيض البشرية ، تفاعل البلمرة المتسلسل.


Article
Molecular Identification of Streptococcus equi subspecies equi in Horses
التحري الجزيئي عن المكورات السبحية الخيلية في الخيول

Loading...
Loading...
Abstract

The objective of this study is to evaluate the existence of Streptococcus equi subspecies equi as probable agents of naturally occurring infection of the equine upper respiratory disease from the Equestrian club in Baghdad city. Nasal swabs and pus samples from 141 horses with upper respiratory tract infections were collected. Results indicated that different microorganisms were isolated and identified S. equi subsp equi (30 isolates), S. equi subsp zooepidemicus (14 isolates), S. equisimilus (9 isolates), Enterococcus. fecalis (17 isolates), Pasteurella spp. (29 isolates), Staphylococcus spp. (25 isolates), Bacillus spp. (24 isolates), Pseudomonas spp.(16 isolates), and E. coli (21 isolates). All 30 isolates of S. equi were characterized by biochemical tests. For molecular identification of the subspecies S. equi one genomic region SeM was amplified.

الهدف من هذه الدراسة تقييم وجود جراثيم المكورات السبحية الخيلية كمسبب طبيعي محتمل لحدوث الاصابة في الجزء العلويللجهاز التنفسي للفصيله الخيلية من نادي الفروسية في مدينة بغداد. تم جمع المسحات الانفية و وعينات القيح من 141 حصان كانتتعاني من اصابات للجهاز التنفسي العلوي .عزلت وصنفت اجناس وانواع مختلفه من الجراثيم هي كالاتي المكورات السبحيةالخيلية S. equi subsp equi 03 عزلة(, ( S. equi subsp zooepidemicus 14 عزلة(, ( S. equisimilus 9 عزلات(, (Enterococcus. Fecalis 11 عزلة(, ( Pasteurella spp. 29 عزلة(, ( Staphylococcus spp. 22 عزلة(, ( Bacillus spp. 24 عزلة(, ( Pseudomonas spp. 11 عزلة( و ( E. coli 21 عزلة(. وكل عزلات المكورات السبحية الخيلية قد ميزت (بواسطة الاختبارات الكيميوحياتية. ولغرض التحري الجزيئي لجرثومة المكورات السبحية الخيلية فقد تم تضخيم منطقة واحدة منالجين SeM الخاص بها.


Article
71 Using PCR technique for diagnosis of bacterium Escherichia coli O157:H7 isolated from urine samples of humans and sheep
إستعمال تقنية (PCR) لتشخيص جرثومة E.coli O157:H7 المعزوله من الأدرار في الانسان والأغنام

Authors: Alwan, M. J. محمد جويد علوان --- Al-wgaa, A. A.@ آلاء عامر شاكر
Journal: The Iraqi Journal of Veterinary Medicine المجلة الطبية البيطرية العراقية ISSN: 16095693 Year: 2014 Volume: 38 Issue: 2 Pages: 17-21
Publisher: Baghdad University جامعة بغداد

Loading...
Loading...
Abstract

The aims of the current study were to determine the percentages of E.coli O157:H7 in the urinary tract infections (UTIs) of humans and in the urine of apparently healthy sheep, and to determine the genotype of the isolates by PCR assay. Two hundred and twenty eight urine samples were collected from young children and adult patients of both sexes suffering from UTIs during a period December 2012 to the end of March 2013. And randomly collected 75 urine samples from apparent healthy sheep of both sexes that were slaughtered in AL Shoela, AL Rahmanea Slaughterhouse and College of Veterinary Medicine field in Baghdad the end of February to half of April 2013. All urine samples were incubated aerobically at 37°C for 24-48 hrs on blood agar, MacConkey agar as well as special media and the isolates were identified by biochemical tests, then the isolates were confirmed and diagnosed by PCR assay. The results showed that of human urine samples ,8 samples were E. coli O157:H7 positive isolates(3.50%) ,young children expressed (4) isolates of E.coli O157:H7 as compared with those in adult (4 isolates) and the percentage of these isolates in females were (2.6%) as compared with those in males (0.87%). Also the current study demonstrated that all isolates culturing positive serotype of E.coliO 157:H7 were positive by PCR assay .The genes of eaeA ,hly and Stx2 were recorded in 7,8 and 2 serotype of E.coliO157:H7 respectively. The result revealed that 21(28%) out 75 sheep urine samples were E.coli positive isolates, 13 out of 75 samples were E.coli O157:H7 positive isolates. The percentage of isolates from ram urine samples was (14.66%) as compared to those samples of ewes (2.66%).The result also recorded that 10,13,12,4 and 3 of bacterial isolates of sheep urine samples carried eaeA, hlyA, hlyA plasmid,Stx1 and Stx2 genes respectively. In conclusion the healthy sheep in Baghdad city, harbor shiga -toxin producing E.coliO157:H7 in their urinary tracts and these organism induced UTIs associated with renal failure in the humans and carried the same virulent genes that reported in the sheep isolates.

الهدف الرئيسي من الدراسة هو لتحديد نسبة اصابة الجهاز البولي في الانسان والاغنام ببكتريا E.coli العترة O157:H7وتشخيصها بتقنية PCR . جمعت 222 عينة إدرار من اشخاص يعانون من اصابات الجهاز البولي ومن الصغار والكبار ومن كلاالجنسين إبتداء من شهر كانون الاول 2102 والى نهايه شهر اذار 2102 .كذلك تم وبشكل عشوائي جمع 57 عينه إدرا ومن كلاالجنسين لأغنام تبدو طبيعية من مجزرة الشعله والرحمانيه وحقل كليه الطب البيطري في بغداد للفترة الواقعة من نهاية شهر شباطالى منتصف شهر نيسان 2102 . زرعت العينات على الاوساط الروتينيه )وسط اكار الدم ووسط المكونكي اكار( وسط خاصوحضنت بدرجه 25 م° لمدة 22 22 ساعه وبعدها تم اجراء الفحوصات الكيمياويه لتأكيد التشخيص ومن ثم زرعها على الاوساط -الخاصه وإستعمال تقنية PCR للتشخيص النهائي. حيث ظهرت 2 عزلات من اصل 222 عينه إدرار موجبه لبكتريا E.coli O157:H7 وبنسبة ) % 2.71 ( منها 2 في الاطفال و 2 في البالغين بنسبه % 2.2 في الاناث مقارنه مع الذكور بنسبه1.25% (.وعند تشخيصها بتقنيه ( PCR كانت 5 عزلات تمتلك eaeA جين و 2 تمتلك hly A جين و 2 تمتلك Stx2 جين.اما فيالاغنام فكانت 20 عزله بنسبه % 22 من اصل 57 عينة هي E.coli موجبة, 02 عزلة من اصل 57 عينة كانت E.coli O157:H7 , بنسبة )% 02.2 ( في الكباش و)% 2.2 ( في النعاج , 01 و 02 و 02 و 2 و 2 تمتلك Stx2 & Stx1,hly A, hly A plasmed, eae A جين وبالتتابع عند تشخيصها بتقنية PCR . وعليه تعتبر الاغنام الميناء لسم الشيكا المنتج من قبل بكترياE.coli O157:H7 التي تسبب عدوى الجهاز البولي والفشل الكلوي في الانسان.

Listing 1 - 10 of 37 << page
of 4
>>
Sort by
Narrow your search

Resource type

article (37)


Language

English (18)

Arabic and English (10)

Arabic (9)


Year
From To Submit

2019 (3)

2018 (6)

2017 (6)

2016 (9)

2015 (4)

More...