research centers


Search results: Found 1

Listing 1 - 1 of 1
Sort by

Article
Identification Of Trichophyton rubrum Using Polymerase Chain Reaction
تشخیص الفطر ترایكوفایتون روبرم بأستخدام تفاعل البلمرة المتسلسل

Loading...
Loading...
Abstract

Trichophyton rubrum is an anthropophilic dermatophyte that is distributed worldwide and causes common cutaneous disease such as mycosis . Although several properties of this fungus have been investigated so far , however , a few studies were carried out in the field of molecular biology of this fungus .In the present study the application of PCR fingerprinting was performed using two primers : forward 5'TGGTCTGGCCTTGACTGACC3' and Reversed 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' for the purpose of species identification .Trichophyton rubrum isolates obtained from either human patients (5 isolates) and animals ( 5 isolates ) with dermatophytosis were prospectively isolated by cultures and identified on morphological basis at Baghdad University , Department of Dermatology , College of Medicine and College of Veterinary Medicine respectively from the period September 2010 till March 2011 .Trichophyton rubrum isolates were subjected to DNA extraction .Conventional PCR was done with Trichophyton rubrum specific primers 5 ' TGGTCTGGCCTTGACTGACC 3 ' and 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' .Six isolates were positive for DNA extraction .A single band corresponding to Trichophyton rubrum was obtained .The results of current study suggest that PCR is simple , rapid and sensitive method for diagnosis of dermatophyte infections .

تعتبر الترايكوفايتون روبرم من الفطريات المحبة للبشر متوزعة في العالم وتسبب الاصابات الفطرية الجلدية مثل المايكوسس . وبالرغم من ان هذة الصفات العديدة لهذا الفطر تم التحري عنها ولكن هنالك دراسات قليلة اجريت في حقل البايولوجي الجزيئي في هذا المجال .في هذة الدراسة تم استخدام فحص البلمرة المتسلسل بوجود نوعان من البرايمير : الاول: 5 ' TGGTCTGGCCTTGACTGACC 3 'والثاني : 5 ' GTAAGGATGGCTAGTTAGGGGG 3 'لغرض التشخيص .تم الحصول على خمسة عزلات مأخوذة من الانسان وخمسة عزلات من الحيوانات حيث تم تشخيصها بواسطة الزرع الفطري في شعبة الامراض الجلدية/ كلية الطب /جامعة بغداد وكلية الطب البيطري /جامعة بغداد بالتسلسل للفترة من ايلول /2010 ولفاية أذار /2012 وقد اخضعت هذة العزلات الى استخلاص DNA مع أستخدم تفاعل البلمرة المتسلسل العادي وكانت ستة عزلات اعطت وجود DNA وتم تحديدها على شكل Band .هذة الدراسة تقترح بأن فحص تفاعل البلمرة المتسلسل هو بسيط ,وسريع وطريقة حساسة لتشخيص أصابات الفطريات الجلدية.

Listing 1 - 1 of 1
Sort by
Narrow your search

Resource type

article (1)


Language

English (1)


Year
From To Submit

2014 (1)