research centers


Search results: Found 5

Listing 1 - 5 of 5
Sort by

Article
A Survey of Dermatophytes Isolated from Cows and Sheep in Iraq
دراسة بحثية عن الفطريات الجلدية المعزولة من الابقار والاغنام في العراق

Authors: Mohammed K Faraj محمد قاسم فرج --- Sudad Jasim Mohammed سداد جاسم محمد
Journal: The Iraqi Journal of Veterinary Medicine المجلة الطبية البيطرية العراقية ISSN: 16095693 Year: 2011 Volume: 35 Issue: 2 Pages: 40-45
Publisher: Baghdad University جامعة بغداد

Loading...
Loading...
Abstract

A total of 100 animals were examined during the period of beginning of September - 2010 till the end of March 2011 at dept of Microbiology college of Veterinary Medicine Baghdad University Baghdad Iraq. These animals include 50 cow and 50 sheep. Hairs and scales were submitted to direct KOH mount smear and culture on modified Sabouraud's Dextrose agar medium The direct smear was positive in 40 ( 80%) for both cows and sheep while the growth of dermatophyte was positive in 35 ( 70%) and 38 ( 76%) for cows and sheep respectively. Species identification revealed the presence of Trichophyton rubrum ( 19 isolates ) Trichophyton verrucosum ( 10 isolates ) Trichophyton mentagrophytes ( 5 isolates ) and Microsporum canis ( one isolate ) in cow while Trichophyton rubrum (22 isolates) Trichophyton verrucosum ( 2 isolates ) and Trichophyton mentagrophytes ( 14 isolates) was recorded in sheep.

تم فحص مائة حالة من الابقار والاغنام خلال الفترة من بداية شهر أيلول 2010 الى نهاية شهر أذار 2011 وفحصت النماذج المأخوذة من الجلد والشعر في كلية الطب البيطري / جامعة بغداد. خضعت النماذج المأخوذة للفحص المباشر بأستخدام الشريحة المرطبة بمحلول هيدروكسيد البوتاسيوم ( (%10 KOHمع الزرع على وسط السابرويد المطور وكانت نتجة الفحص المباشر 40 (80%) لكل من الابقار بينما كان نمو الفطريات الجلدية موجبة في 35 (70%) و 38 ( 76%) للابقار والاغنام على التوالي. أظهر فحص تشخيص الانواع ففي الابقار وجود 19 عزلة للنوع Trichophyton rubrum 10عزلات نوع Trichophyto verrucosum و 5 عزلات للنوع Trichophyton mentagrophytesو عزلة واحدة للنوع Microsporum canis بينما في الاغنام شخصت 22 عزلة من النوع Trichophyton rubrum و عزلتان من النوع Trichophyton verrucosumو 14 عزلة من النوع Trichophyton mentagrophyte.


Article
Identification Of Trichophyton rubrum Using Polymerase Chain Reaction
تشخیص الفطر ترایكوفایتون روبرم بأستخدام تفاعل البلمرة المتسلسل

Loading...
Loading...
Abstract

Trichophyton rubrum is an anthropophilic dermatophyte that is distributed worldwide and causes common cutaneous disease such as mycosis . Although several properties of this fungus have been investigated so far , however , a few studies were carried out in the field of molecular biology of this fungus .In the present study the application of PCR fingerprinting was performed using two primers : forward 5'TGGTCTGGCCTTGACTGACC3' and Reversed 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' for the purpose of species identification .Trichophyton rubrum isolates obtained from either human patients (5 isolates) and animals ( 5 isolates ) with dermatophytosis were prospectively isolated by cultures and identified on morphological basis at Baghdad University , Department of Dermatology , College of Medicine and College of Veterinary Medicine respectively from the period September 2010 till March 2011 .Trichophyton rubrum isolates were subjected to DNA extraction .Conventional PCR was done with Trichophyton rubrum specific primers 5 ' TGGTCTGGCCTTGACTGACC 3 ' and 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' .Six isolates were positive for DNA extraction .A single band corresponding to Trichophyton rubrum was obtained .The results of current study suggest that PCR is simple , rapid and sensitive method for diagnosis of dermatophyte infections .

تعتبر الترايكوفايتون روبرم من الفطريات المحبة للبشر متوزعة في العالم وتسبب الاصابات الفطرية الجلدية مثل المايكوسس . وبالرغم من ان هذة الصفات العديدة لهذا الفطر تم التحري عنها ولكن هنالك دراسات قليلة اجريت في حقل البايولوجي الجزيئي في هذا المجال .في هذة الدراسة تم استخدام فحص البلمرة المتسلسل بوجود نوعان من البرايمير : الاول: 5 ' TGGTCTGGCCTTGACTGACC 3 'والثاني : 5 ' GTAAGGATGGCTAGTTAGGGGG 3 'لغرض التشخيص .تم الحصول على خمسة عزلات مأخوذة من الانسان وخمسة عزلات من الحيوانات حيث تم تشخيصها بواسطة الزرع الفطري في شعبة الامراض الجلدية/ كلية الطب /جامعة بغداد وكلية الطب البيطري /جامعة بغداد بالتسلسل للفترة من ايلول /2010 ولفاية أذار /2012 وقد اخضعت هذة العزلات الى استخلاص DNA مع أستخدم تفاعل البلمرة المتسلسل العادي وكانت ستة عزلات اعطت وجود DNA وتم تحديدها على شكل Band .هذة الدراسة تقترح بأن فحص تفاعل البلمرة المتسلسل هو بسيط ,وسريع وطريقة حساسة لتشخيص أصابات الفطريات الجلدية.


Article
The Incidence of Dermatophytosis in Babylon Province, Iraq

Author: Oday Hussein Kadhim
Journal: Medical Journal of Babylon مجلة بابل الطبية ISSN: 1812156X 23126760 Year: 2018 Volume: 15 Issue: 3 Pages: 234-237
Publisher: Babylon University جامعة بابل

Loading...
Loading...
Abstract

Background: Dermatophytosis is caused by dermatophytes, which attack and grow on dead animal keratin. Dermatophytes belong to threegenera, namely, Epidermophyton, Microsporum, and Trichophyton. Objective: The objective of this study is to detect the types and thefrequencies of the dermatophytes infections in Babylon Province. Materials and Methods: In this study, 200 specimens of dermatophyticpatients are collected in Babylon Province. Collection of Specimens includes skin scrapings, hair fragments, and nail clippings. The specimenswere diagnosed by direct microscopic examination and culture. Results: One hundred and sixty‑four (83%) specimens of dermatophyteinfection were positive in culture and used in phenotypic diagnosis. Tinea corporis was the predominant infection in 83 (41.5%) patients,Trichophyton rubrum showed the highest frequency of dermatophytes isolates 29 (17.68%), Trichophyton mentagrophytes 26 (15.85%), andMicrosporum canis 24 (14.63%). Fifty‑six cases were positive in direct microscopic examination, and the invasion of hair was ectothrix type,forming masses of arthroconidia on the outside of the hair shaft in 44 (78.57%) specimens, while the invasion of hair was endothrix type,and abundant sporulation inside the hair shaft causes breakage of the hair near the surface of the scalp in 12 (22.43%) specimens (P < 0.05).The age group of 21–30 years revealed tendency for dermatophytosis of tinea corporis while the age group of 1–10 years showed tendencyfor dermatophytosis of tinea capitis. Conclusion: Tinea corporis was the predominant infection. T. rubrum, T. mentagrophytes, and M. canisshowed the highest frequency of dermatophyte isolates. Positive direct microscopic examination and culture isolates (phenotypic diagnosis)could be used in the diagnosis of dermatophytosis.


Article
The Influence of molecular Effects on Laser Nd:YAG and Diode on Trichophyton Rubrum fungi using RAPD marker
تقييم التأثيرات الجزيئية لليزر Nd: YAG وليزر Diode على فطر Trichophyton Rubrum بإستخدام مؤشر ال RAPD

Loading...
Loading...
Abstract

This study was carried out to assess the morphological and molecular effects of the Nd: yag and Diode (semiconductor) lasers on Trichophyton rubrum Fungi using RAPD marke . Sixty samples of skin patches, nail clippings and parts of hair were collected from infected patients of both sexes (34 males and 26 females) for the age group (1-60) year of patients who have attended to Tikrit Teaching Hospital. The T.rubrum fungi was the most common among the skin fungi, T.rubrum radiated by using two lasers: the Nd: yag laser with a wavelength (530) nm and energy (300, 500, 700) mJ and for two times exposing 20 and 30 seconds by six coefficients and control sample, the low-density diode (5 mW) for 3 times 10, 20 and 30 seconds on distance 20 cm with three treatments and a control sample. DNA was extracted from the fungus after direct exposure and after leaving it to grow for a whole generation and then was used to complete RAPD reactions using five primers. The RAPD marker gave excellent results with all primers, It was noted that the exposure of T. rubrum to the Nd: yag and Diode lasers with different cards and times had different effects on DNA and caused significant changes in the RAPD patterns compared with the control group, new bands appear and others disappear. The energy affecting the fungus T.rubrum for the first laser Nd: yag is 500 mj at time 30 sec while the power of the laser Diode was 5 mw at time 20 sec. The results suggested that the diode laser is highly effective and has a great effect on the genetic material of fungi compared with the effect of the first laser. The conclusion that the use of laser can affect DNA of skin fungi and may lead to mutations which means that it can be used in the treatment of skin fungal infections and the RAPD was effective in detecting the effect of laser at the molecular level as a simple, and inexpensive.

اجريت هذه الدراسة لتقييم التأثيرات المظهرية والجزيئية لليزر النديميوم- ياك والدايود (شبه الموصل) على فطر Trichophyton Rubrum باستخدام مؤشر التضاعف العشوائي المتعدد الأشكال لسلسلة الدنا ال (RAPD). جمعت ستين عينة كقشطات جلدية، قصاصات الأظافر واجزاء من الشعر من المرضى المصابين من كلا الجنسين (الذكور 34 والأناث 26) للفئة العمرية (60 – 1) سنة من المرضى المراجعين لمستشفى تكريت التعليمي. زرعت العينات وتم تنميتها على الاوساط الزرعية ثم شخصت الاجناس والانواع الفطرية, تم شعع الفطر T.rubrum كونه الاكثر انتشاراً بين الفطريات الجلدية باستخدام ليزرين هما ليزر الندميوم- ياك بطول موجي(530)nm وطاقة (300 , 500 , 700) ملي جول ولزمنين تعريض20 و 30 ثانية لكل بواقع ست معاملات وعينة سيطرة، وليزر الدايود ذو القدرة الواطئة (5) ملي واط لثلاثة أزمنة 10 و 20 و30 ثانية على مسافة 20 سنتيمتر بواقع ثلاث معاملات وعينة سيطرة, استخلص الدنا من الفطريات بعد التعرض المباشر وبعد تركها لتنمو لمدة جيل كامل ثم استخدم لانجاز تفاعلات مؤشر ال (RAPD). اعطى مؤشر ال RAPDنتائج ممتازة مع البادئات الخمسة المستخدمة وتبين ان تعرض فطر T.rubrum لليزر النديميوم- ياك والدايود بطاقات وازمنة مختلفة قد اثر على (DNA) وسبب تغيرات كبيرة في انماط مؤشر ال RAPD بالمقارنة مع مجموعة السيطرة من ناحية ظهور حزم جديدة واختفاء حزم كانت موجودة وان الطاقة المؤثرة على الفطر T.rubrum للليزر الأول النديميوم- ياك هي 500 mj عند الزمن 30 sec والطاقة المؤثرة لليزر Diode كانت 5 mw عند الزمن 20 sec ، كما تبين ان ليزر الدايود ذو فعالية عالية وتأثير كبير على المادة الوراثية للفطر بالمقارنة مع تأثير الليزر الاول. يمكن ان نستنتج ان استعمال الليزر يمكن ان يؤثر على ال (DNA) للفطريات الجلدية وقد يؤدي الى حصول طفرات مما يعني امكانية استخدامه في علاج الاصابات الفطرية الجلدية كما ان مؤشر ال RAPD كان كفوء في الكشف عن تأثير الليزر على المستوى الجزيئي باعتبارها تقنية بسيطة, سريعة وغير مكلفة.


Article
Study genetic diversity between trichophyton rubrum isolates using ISSR and RAPD markers
دراسة التغايرات الوراثيه بين عزلات الفطر Trichophyton rubrumبواسطه مؤشرات الـ ISSR و RAPD

Loading...
Loading...
Abstract

The present study included detection of genetic variability, and identification of genetic relationship and finding a fingerprint of the ten clinical isolates related to Trichophyton rubrum using RAPD and ISSR markers. The experiment was carried out and the results performed using six primer of the RAPD markers these primers showed 239 amplified band , out of these band 90 of them was considered as a main band, and 149 was Polymorphic band , the largest number of bands was 30 in the isolate TR6 and less number of bands in the isolate TR7. The results clear the value of genetic diversity based on RAPD analysis the lowest value of genetic diversity (0.13005) between the isolate TR3 and TR9while the highest genetic diversity (0.55941) was between the isolates TR5 and TR8. The analysis of the relationship shows that there are three main groups: the first group include isolate TR8, while the second group included three isolates are isolate TR2, isolate TR10 and isolates TR3, The third group included three subgroups included the first isolate TR1,isolates TR4 and second isolate TR3 and isolate TR9 and the third included the isolate TR5 and isolates TR6.The results of ISSR experiments: the use six a primers in the of the ISSR showed 192 bands, in the isolate of Trichophyton rubrum, two of these primers showed monomorphic bands (in number and location) and six primers showed monomorphic and polymorphic bands, while one showed only polymorphic bands among Trichophyton rubrum isolates. And the largest number of bands was 24 in the TR5 and less number of bands 16 in isolate TR3 and isolate TR8 were finding DNA fingerprint to isolate TR1, isolate TR5, and isolate TR3. The ISSR markers showed lowest genetic polymorphism was (0.05561) between the isolates TR2 and isolate TR7 and the largest genetic distance was (0.40501) between the isolate TR4 and isolate TR8. The analysis of the relationship of genetic showed that there are three groups key first included isolates and only one isolate TR8 and the second involving isolates TR2 and isolate TR7, isolate TR4 and isolate TR3, while the group included three sub-groups, the first included isolate TR1 and isolate TR6, and the second involving isolate TR5, isolate TR10 and isolate TR9. The results confirmed the efficiency markers of the RAPD and ISSR in contrast, find a genetic fingerprint to the isolates of Trichophyton rubrum, and these markers differ in mechanical detection contrast, and coverage is Genome. Therefore Complementary to each other, although the ISSR markers were more efficient in terms of the number of binding sites in each type of the isolates of Trichophyton rubrum and so can the initiator of the discovery of a much larger area from Genome.

تم في هذه الدراسة تحديد العلاقة الوراثية ، تحديد البعد الوراثي، وإيجاد البصمة الوراثية لعشرة عزلات من الفطر Trichophyton rubrum باستخدام مؤشرات RAPD وISSR. حيث درست تفاعلات الـ RAPD باستخدام 6 بادئات واظهرت البادئات 239 حزمة، منها 90 حزمة رئيسيهmain band و 149 حزمة متباينة Polymorphic band , وكان اكبر عدد من مواقع الارتباط 30 موقع في العزله (6)، وأقل عدد من كان 20 موقع في العزله (7) . واستثمرت تلك النتائج لدراسة التباين الوراثي بين العزلات الداخلة في الدراسة.ظهر من خلال نتائج البعد الوراثي لتفاعلات الـ RAPD ان اقل قيمة كانت (0.13005) بين العزله (3) و (9) ،وأعلى قيمة كانت (0.55941) بين العزلات (5) و (8) .بينما اظهر تحليل العلاقة الوراثية ان هناك ثلاث مجاميع رئيسة ضمت الاولى العزله رقم (8) ،اما المجموعة الثانية فقد ضمت ثلاثة عزلات من الفطر هي (2) و(10) و(7)، وشملت المجموعة الثالثة ثلاث مجاميع فرعية ضمت الاولى العزله (1) و(4)، والثانية العزلات (3) و(9)،والثالثة العزلات (5) و (6) . اما نتائج تفاعلات الـ ISSR والتي استخدام فيها 6 بادئات أظهرت 192 حزمة، حزماً متماثلة في البادئين ISSR2وISSR9، واربع أظهرت حزم متباينة ومتماثلة، بينما اظهر البادئ ISSR10 حزما متباينة فقط بين انواع عزلات الفطرTrichophyton rubrum. واكبر عدد من الحزم ظهر كان 24 في العزله (5) واقل عدد من الحزم 16 في العزلتين (3) و (8) ، وتم ايجاد البصمة الوراثية لـلعزله (1) (5) و (8). وأظهرت مؤشرات الـ ISSR ان اقل بعد وراثي كان (0.05561) بين العزلتين (2) و (7)، واكبر بعد وراثي كان (0.40501) بين عزلتي الفطرTrichophyton rubrum(4) و (8) . اما تحليل العلاقة الوراثية فأظهر ان هناك ثلاث مجاميع رئيسة ، الاولى ضمت عزله واحده فقط هي (8) ، والثانية ضمت (2) و(7) و (4) و (3) بينما ضمت المجموعة الثالثة مجموعتين فرعيتين ، الأولى ضمت العزلتين (1) و(6)، والثانية ضمت (5) و(10) و(9). وقد اكدت النتائج كفاءة مؤشرات الـ RAPD و ISSR في ايجاد التباين والبصمة الوراثية لعزلات الفطرTrichophyton rubrum، وان هذه المؤشرات تختلف في ميكانيكية اكتشاف التباين، وتغطية المجين ، لذلك تعـتبر مكملة لبعضها، بالرغم من ان بعض بادئات مؤشر الـ ISSR كانت اكثر كفاءة من حيث عدد مواقع الارتباط المتباينة بين عزلات الفطر Trichophyton rubrum.

Listing 1 - 5 of 5
Sort by
Narrow your search

Resource type

article (5)


Language

English (4)

Arabic and English (1)


Year
From To Submit

2019 (1)

2018 (2)

2014 (1)

2011 (1)